Incidental Mutation 'R7398:Gas8'
ID573968
Institutional Source Beutler Lab
Gene Symbol Gas8
Ensembl Gene ENSMUSG00000040220
Gene Namegrowth arrest specific 8
SynonymsGas11
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.364) question?
Stock #R7398 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location123518834-123536650 bp(+) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) T to A at 123518951 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 1 (M1K)
Ref Sequence ENSEMBL: ENSMUSP00000090730 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093043] [ENSMUST00000127664] [ENSMUST00000176155] [ENSMUST00000176286] [ENSMUST00000177240] [ENSMUST00000212923]
Predicted Effect probably null
Transcript: ENSMUST00000093043
AA Change: M1K

PolyPhen 2 Score 0.094 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000090730
Gene: ENSMUSG00000040220
AA Change: M1K

DomainStartEndE-ValueType
low complexity region 4 14 N/A INTRINSIC
coiled coil region 26 105 N/A INTRINSIC
coiled coil region 164 199 N/A INTRINSIC
Pfam:GAS 221 420 1.5e-82 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176155
SMART Domains Protein: ENSMUSP00000135524
Gene: ENSMUSG00000031970

DomainStartEndE-ValueType
low complexity region 16 31 N/A INTRINSIC
Pfam:Dysbindin 44 189 3.6e-61 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176286
SMART Domains Protein: ENSMUSP00000134757
Gene: ENSMUSG00000031970

DomainStartEndE-ValueType
low complexity region 16 31 N/A INTRINSIC
Pfam:Dysbindin 44 96 3.1e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177240
SMART Domains Protein: ENSMUSP00000135216
Gene: ENSMUSG00000031970

DomainStartEndE-ValueType
low complexity region 16 31 N/A INTRINSIC
Pfam:Dysbindin 44 101 4.5e-10 PFAM
Pfam:Dysbindin 96 142 2.7e-14 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000212923
AA Change: M1K

PolyPhen 2 Score 0.312 (Sensitivity: 0.90; Specificity: 0.89)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene includes 11 exons spanning 25 kb and maps to a region of chromosome 16 that is sometimes deleted in breast and prostrate cancer. The second intron contains an apparently intronless gene, C16orf3, that is transcribed in the opposite orientation. This gene is a putative tumor suppressor gene. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2013]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit postnatal lethality, severe hydrocephaly, situs inversus with levocardia and abnormal cilia morphology and function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abl1 T A 2: 31,790,799 S368T probably damaging Het
Acmsd A G 1: 127,729,435 probably benign Het
Arid3b A T 9: 57,796,212 S445T probably benign Het
Brinp1 A G 4: 68,841,354 V91A probably benign Het
Ccne1 A G 7: 38,106,277 probably null Het
Col3a1 A T 1: 45,327,813 I249F unknown Het
Crybg3 T C 16: 59,557,325 I1189V probably benign Het
Cyp2d34 A T 15: 82,616,763 D389E probably benign Het
D130043K22Rik A C 13: 24,893,377 I998L probably damaging Het
Dgkq A G 5: 108,655,190 I298T possibly damaging Het
Dnah17 T C 11: 118,080,724 E2161G probably damaging Het
Dnajc25 T C 4: 59,017,824 probably null Het
Dpp9 G A 17: 56,189,405 R768* probably null Het
Dusp27 A G 1: 166,100,475 S523P probably damaging Het
Dusp6 T A 10: 99,264,878 N245K probably damaging Het
E430018J23Rik C T 7: 127,393,324 C38Y probably null Het
Eea1 C A 10: 95,995,631 H195N probably benign Het
Efhc1 A G 1: 20,989,520 E598G probably benign Het
Epb41l1 T C 2: 156,534,762 V809A probably damaging Het
Gcm1 G A 9: 78,064,679 V301I probably benign Het
Gm11554 T A 11: 99,804,259 S43C unknown Het
Gm7298 A G 6: 121,781,953 I1177V probably benign Het
Gm8011 A G 14: 42,463,961 T27A Het
Hmcn1 A G 1: 150,646,670 I3493T probably benign Het
Insrr T G 3: 87,808,732 I578S probably damaging Het
Kif13b A G 14: 64,757,523 D908G probably null Het
Lhcgr G C 17: 88,772,046 Q71E probably benign Het
Lrrc34 T C 3: 30,643,342 D80G probably damaging Het
Lrrc7 C A 3: 158,291,958 E156* probably null Het
Lrrc9 A G 12: 72,500,816 D1255G probably damaging Het
Mcidas A G 13: 112,996,882 N116D probably benign Het
Mmp7 A G 9: 7,697,593 N210D probably damaging Het
Morc3 A G 16: 93,874,860 D926G probably damaging Het
Mrgpra9 A G 7: 47,235,637 I94T possibly damaging Het
Muc16 C A 9: 18,637,742 V5752F possibly damaging Het
Myo16 A T 8: 10,562,183 D1276V unknown Het
Nlrc4 T G 17: 74,446,542 E282A probably damaging Het
Nos2 T A 11: 78,936,471 Y227* probably null Het
Obox5 A C 7: 15,758,788 M223L probably benign Het
Olfr1337 C A 4: 118,781,699 L295F possibly damaging Het
Pygm G A 19: 6,385,936 R139H probably damaging Het
Ranbp2 C A 10: 58,467,277 P789T probably damaging Het
Riok2 T G 17: 17,387,239 S350A probably benign Het
Rnf214 C T 9: 45,867,547 V445I possibly damaging Het
Skida1 C T 2: 18,046,272 V603I unknown Het
Skint6 T A 4: 112,898,138 R747S probably benign Het
Slc24a5 G A 2: 125,085,774 W331* probably null Het
Slc5a10 A T 11: 61,673,579 C525S probably benign Het
Sult2b1 T C 7: 45,731,294 Y288C probably damaging Het
Tagln3 G T 16: 45,723,077 N67K probably damaging Het
Trav21-dv12 A T 14: 53,876,705 H94L probably benign Het
Tshz2 A G 2: 169,884,174 E230G probably damaging Het
Usb1 T A 8: 95,345,303 H210Q probably damaging Het
Vill C T 9: 119,070,648 P767L probably benign Het
Vmn2r94 A T 17: 18,257,341 N269K probably benign Het
Other mutations in Gas8
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0689:Gas8 UTSW 8 123524106 missense probably damaging 1.00
R1552:Gas8 UTSW 8 123520646 missense probably benign 0.00
R2068:Gas8 UTSW 8 123526537 missense probably damaging 0.96
R4722:Gas8 UTSW 8 123525635 missense possibly damaging 0.88
R4840:Gas8 UTSW 8 123531014 missense probably benign 0.25
R5424:Gas8 UTSW 8 123526512 missense possibly damaging 0.58
R6511:Gas8 UTSW 8 123524157 missense probably benign 0.00
R6520:Gas8 UTSW 8 123526474 missense probably benign 0.03
R7318:Gas8 UTSW 8 123530968 missense probably benign
R7623:Gas8 UTSW 8 123522979 missense probably damaging 0.96
R7652:Gas8 UTSW 8 123526536 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAACACTAGCTCTTCTGGCG -3'
(R):5'- CCCAGAGAACCTGAATGCAG -3'

Sequencing Primer
(F):5'- CGTTGTTAGGGACGCACTC -3'
(R):5'- CTGAATGCAGGCCCCGG -3'
Posted On2019-09-13