Incidental Mutation 'R7398:Arid3b'
ID573972
Institutional Source Beutler Lab
Gene Symbol Arid3b
Ensembl Gene ENSMUSG00000004661
Gene NameAT rich interactive domain 3B (BRIGHT-like)
SynonymsBdp, Dri2
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7398 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location57790353-57836793 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 57796212 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 445 (S445T)
Ref Sequence ENSEMBL: ENSMUSP00000004780 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004780] [ENSMUST00000098686] [ENSMUST00000114165] [ENSMUST00000164010] [ENSMUST00000164035] [ENSMUST00000170477] [ENSMUST00000171444] [ENSMUST00000171949]
Predicted Effect probably benign
Transcript: ENSMUST00000004780
AA Change: S445T

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000004780
Gene: ENSMUSG00000004661
AA Change: S445T

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
low complexity region 88 116 N/A INTRINSIC
ARID 210 301 9.52e-35 SMART
BRIGHT 214 306 6.43e-39 SMART
low complexity region 339 358 N/A INTRINSIC
low complexity region 372 386 N/A INTRINSIC
low complexity region 528 559 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098686
AA Change: S445T

PolyPhen 2 Score 0.084 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000096283
Gene: ENSMUSG00000004661
AA Change: S445T

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
low complexity region 88 116 N/A INTRINSIC
ARID 210 301 9.52e-35 SMART
BRIGHT 214 306 6.43e-39 SMART
low complexity region 339 358 N/A INTRINSIC
low complexity region 372 386 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114165
SMART Domains Protein: ENSMUSP00000109802
Gene: ENSMUSG00000004661

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
low complexity region 88 116 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164010
SMART Domains Protein: ENSMUSP00000126889
Gene: ENSMUSG00000004661

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
low complexity region 88 116 N/A INTRINSIC
SCOP:d1c20a_ 174 240 6e-9 SMART
PDB:4LJX|B 204 238 4e-9 PDB
Blast:ARID 210 231 5e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000164035
SMART Domains Protein: ENSMUSP00000131677
Gene: ENSMUSG00000004661

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
low complexity region 88 116 N/A INTRINSIC
SCOP:d1c20a_ 174 233 2e-8 SMART
PDB:4LJX|B 204 268 1e-10 PDB
Blast:ARID 210 267 3e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000170477
Predicted Effect probably benign
Transcript: ENSMUST00000171444
AA Change: S445T

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000130173
Gene: ENSMUSG00000004661
AA Change: S445T

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
low complexity region 88 116 N/A INTRINSIC
ARID 210 301 9.52e-35 SMART
BRIGHT 214 306 6.43e-39 SMART
low complexity region 339 358 N/A INTRINSIC
low complexity region 372 386 N/A INTRINSIC
low complexity region 528 559 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171949
AA Change: S4T

PolyPhen 2 Score 0.270 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000127525
Gene: ENSMUSG00000004661
AA Change: S4T

DomainStartEndE-ValueType
low complexity region 54 85 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ARID (AT-rich interaction domain) family of DNA-binding proteins. The encoded protein is homologous with two proteins that bind to the retinoblastoma gene product, and also with the mouse Bright and Drosophila dead ringer proteins. A pseudogene on chromosome 1p31 exists for this gene. Members of the ARID family have roles in embryonic patterning, cell lineage gene regulation, cell cycle control, transcriptional regulation and possibly in chromatin structure modification. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele die before E11.5 displaying variable phenotypes associated with impaired generation of cranial-mesenchymal cells in the first and second branchial arches. Common defects include a wavy neural tube, small branchial arches, and a defective cardiovascular system. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abl1 T A 2: 31,790,799 S368T probably damaging Het
Acmsd A G 1: 127,729,435 probably benign Het
Brinp1 A G 4: 68,841,354 V91A probably benign Het
Ccne1 A G 7: 38,106,277 probably null Het
Col3a1 A T 1: 45,327,813 I249F unknown Het
Crybg3 T C 16: 59,557,325 I1189V probably benign Het
Cyp2d34 A T 15: 82,616,763 D389E probably benign Het
D130043K22Rik A C 13: 24,893,377 I998L probably damaging Het
Dgkq A G 5: 108,655,190 I298T possibly damaging Het
Dnah17 T C 11: 118,080,724 E2161G probably damaging Het
Dnajc25 T C 4: 59,017,824 probably null Het
Dpp9 G A 17: 56,189,405 R768* probably null Het
Dusp27 A G 1: 166,100,475 S523P probably damaging Het
Dusp6 T A 10: 99,264,878 N245K probably damaging Het
E430018J23Rik C T 7: 127,393,324 C38Y probably null Het
Eea1 C A 10: 95,995,631 H195N probably benign Het
Efhc1 A G 1: 20,989,520 E598G probably benign Het
Epb41l1 T C 2: 156,534,762 V809A probably damaging Het
Gas8 T A 8: 123,518,951 M1K probably null Het
Gcm1 G A 9: 78,064,679 V301I probably benign Het
Gm11554 T A 11: 99,804,259 S43C unknown Het
Gm7298 A G 6: 121,781,953 I1177V probably benign Het
Gm8011 A G 14: 42,463,961 T27A Het
Hmcn1 A G 1: 150,646,670 I3493T probably benign Het
Insrr T G 3: 87,808,732 I578S probably damaging Het
Kif13b A G 14: 64,757,523 D908G probably null Het
Lhcgr G C 17: 88,772,046 Q71E probably benign Het
Lrrc34 T C 3: 30,643,342 D80G probably damaging Het
Lrrc7 C A 3: 158,291,958 E156* probably null Het
Lrrc9 A G 12: 72,500,816 D1255G probably damaging Het
Mcidas A G 13: 112,996,882 N116D probably benign Het
Mmp7 A G 9: 7,697,593 N210D probably damaging Het
Morc3 A G 16: 93,874,860 D926G probably damaging Het
Mrgpra9 A G 7: 47,235,637 I94T possibly damaging Het
Muc16 C A 9: 18,637,742 V5752F possibly damaging Het
Myo16 A T 8: 10,562,183 D1276V unknown Het
Nlrc4 T G 17: 74,446,542 E282A probably damaging Het
Nos2 T A 11: 78,936,471 Y227* probably null Het
Obox5 A C 7: 15,758,788 M223L probably benign Het
Olfr1337 C A 4: 118,781,699 L295F possibly damaging Het
Pygm G A 19: 6,385,936 R139H probably damaging Het
Ranbp2 C A 10: 58,467,277 P789T probably damaging Het
Riok2 T G 17: 17,387,239 S350A probably benign Het
Rnf214 C T 9: 45,867,547 V445I possibly damaging Het
Skida1 C T 2: 18,046,272 V603I unknown Het
Skint6 T A 4: 112,898,138 R747S probably benign Het
Slc24a5 G A 2: 125,085,774 W331* probably null Het
Slc5a10 A T 11: 61,673,579 C525S probably benign Het
Sult2b1 T C 7: 45,731,294 Y288C probably damaging Het
Tagln3 G T 16: 45,723,077 N67K probably damaging Het
Trav21-dv12 A T 14: 53,876,705 H94L probably benign Het
Tshz2 A G 2: 169,884,174 E230G probably damaging Het
Usb1 T A 8: 95,345,303 H210Q probably damaging Het
Vill C T 9: 119,070,648 P767L probably benign Het
Vmn2r94 A T 17: 18,257,341 N269K probably benign Het
Other mutations in Arid3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00432:Arid3b APN 9 57833924 missense possibly damaging 0.92
IGL01394:Arid3b APN 9 57795034 missense probably damaging 1.00
IGL01950:Arid3b APN 9 57794974 missense probably damaging 1.00
R0970:Arid3b UTSW 9 57833551 intron probably benign
R1848:Arid3b UTSW 9 57796677 nonsense probably null
R1940:Arid3b UTSW 9 57796148 missense possibly damaging 0.86
R4290:Arid3b UTSW 9 57790430 unclassified probably benign
R4293:Arid3b UTSW 9 57790430 unclassified probably benign
R4424:Arid3b UTSW 9 57833868 missense probably benign 0.22
R4449:Arid3b UTSW 9 57798121 nonsense probably null
R5353:Arid3b UTSW 9 57795037 splice site probably null
R5544:Arid3b UTSW 9 57798097 nonsense probably null
R6828:Arid3b UTSW 9 57810163 critical splice donor site probably null
R7168:Arid3b UTSW 9 57805535 missense probably benign 0.00
R7254:Arid3b UTSW 9 57796754 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TACTGCCACTAAGCCTGAGC -3'
(R):5'- AGAAGCTCAGTGTGTCTGC -3'

Sequencing Primer
(F):5'- CACTAAGCCTGAGCAGAGCTG -3'
(R):5'- CTCAGTGTGTCTGCCCAGGATG -3'
Posted On2019-09-13