Incidental Mutation 'R7398:Gcm1'
ID573973
Institutional Source Beutler Lab
Gene Symbol Gcm1
Ensembl Gene ENSMUSG00000023333
Gene Nameglial cells missing homolog 1
Synonymsglide, GCMa, Gcm a, Gcm 1, Gcm1-rs1, glial cell deficient
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7398 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location78051924-78065624 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 78064679 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 301 (V301I)
Ref Sequence ENSEMBL: ENSMUSP00000024104 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024104]
PDB Structure
STRUCTURE OF THE GCM DOMAIN BOUND TO DNA [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000024104
AA Change: V301I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000024104
Gene: ENSMUSG00000023333
AA Change: V301I

DomainStartEndE-ValueType
Pfam:GCM 30 167 4.2e-75 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA-binding protein with a gcm-motif (glial cell missing motif). The encoded protein is a homolog of the Drosophila glial cells missing gene (gcm). This protein binds to the GCM-motif (A/G)CCCGCAT, a novel sequence among known targets of DNA-binding proteins. The N-terminal DNA-binding domain confers the unique DNA-binding activity of this protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired branching of the chorioallantoic interface, absence of the placental labyrinth, lack of fusion of chorionic trophoblast cells, and lethality between embryonic days 5.5-10. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abl1 T A 2: 31,790,799 S368T probably damaging Het
Acmsd A G 1: 127,729,435 probably benign Het
Arid3b A T 9: 57,796,212 S445T probably benign Het
Brinp1 A G 4: 68,841,354 V91A probably benign Het
Ccne1 A G 7: 38,106,277 probably null Het
Col3a1 A T 1: 45,327,813 I249F unknown Het
Crybg3 T C 16: 59,557,325 I1189V probably benign Het
Cyp2d34 A T 15: 82,616,763 D389E probably benign Het
D130043K22Rik A C 13: 24,893,377 I998L probably damaging Het
Dgkq A G 5: 108,655,190 I298T possibly damaging Het
Dnah17 T C 11: 118,080,724 E2161G probably damaging Het
Dnajc25 T C 4: 59,017,824 probably null Het
Dpp9 G A 17: 56,189,405 R768* probably null Het
Dusp27 A G 1: 166,100,475 S523P probably damaging Het
Dusp6 T A 10: 99,264,878 N245K probably damaging Het
E430018J23Rik C T 7: 127,393,324 C38Y probably null Het
Eea1 C A 10: 95,995,631 H195N probably benign Het
Efhc1 A G 1: 20,989,520 E598G probably benign Het
Epb41l1 T C 2: 156,534,762 V809A probably damaging Het
Gas8 T A 8: 123,518,951 M1K probably null Het
Gm11554 T A 11: 99,804,259 S43C unknown Het
Gm7298 A G 6: 121,781,953 I1177V probably benign Het
Gm8011 A G 14: 42,463,961 T27A Het
Hmcn1 A G 1: 150,646,670 I3493T probably benign Het
Insrr T G 3: 87,808,732 I578S probably damaging Het
Kif13b A G 14: 64,757,523 D908G probably null Het
Lhcgr G C 17: 88,772,046 Q71E probably benign Het
Lrrc34 T C 3: 30,643,342 D80G probably damaging Het
Lrrc7 C A 3: 158,291,958 E156* probably null Het
Lrrc9 A G 12: 72,500,816 D1255G probably damaging Het
Mcidas A G 13: 112,996,882 N116D probably benign Het
Mmp7 A G 9: 7,697,593 N210D probably damaging Het
Morc3 A G 16: 93,874,860 D926G probably damaging Het
Mrgpra9 A G 7: 47,235,637 I94T possibly damaging Het
Muc16 C A 9: 18,637,742 V5752F possibly damaging Het
Myo16 A T 8: 10,562,183 D1276V unknown Het
Nlrc4 T G 17: 74,446,542 E282A probably damaging Het
Nos2 T A 11: 78,936,471 Y227* probably null Het
Obox5 A C 7: 15,758,788 M223L probably benign Het
Olfr1337 C A 4: 118,781,699 L295F possibly damaging Het
Pygm G A 19: 6,385,936 R139H probably damaging Het
Ranbp2 C A 10: 58,467,277 P789T probably damaging Het
Riok2 T G 17: 17,387,239 S350A probably benign Het
Rnf214 C T 9: 45,867,547 V445I possibly damaging Het
Skida1 C T 2: 18,046,272 V603I unknown Het
Skint6 T A 4: 112,898,138 R747S probably benign Het
Slc24a5 G A 2: 125,085,774 W331* probably null Het
Slc5a10 A T 11: 61,673,579 C525S probably benign Het
Sult2b1 T C 7: 45,731,294 Y288C probably damaging Het
Tagln3 G T 16: 45,723,077 N67K probably damaging Het
Trav21-dv12 A T 14: 53,876,705 H94L probably benign Het
Tshz2 A G 2: 169,884,174 E230G probably damaging Het
Usb1 T A 8: 95,345,303 H210Q probably damaging Het
Vill C T 9: 119,070,648 P767L probably benign Het
Vmn2r94 A T 17: 18,257,341 N269K probably benign Het
Other mutations in Gcm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00690:Gcm1 APN 9 78065016 missense probably benign 0.09
IGL02132:Gcm1 APN 9 78064839 missense possibly damaging 0.95
IGL02820:Gcm1 APN 9 78064562 missense probably benign
IGL03074:Gcm1 APN 9 78064775 missense possibly damaging 0.84
PIT4280001:Gcm1 UTSW 9 78059633 missense probably damaging 1.00
R0720:Gcm1 UTSW 9 78064641 missense possibly damaging 0.68
R1271:Gcm1 UTSW 9 78059577 missense probably benign 0.05
R1421:Gcm1 UTSW 9 78059700 missense probably damaging 1.00
R1481:Gcm1 UTSW 9 78059717 nonsense probably null
R1884:Gcm1 UTSW 9 78059579 missense probably benign 0.01
R1907:Gcm1 UTSW 9 78064773 missense probably benign 0.00
R2029:Gcm1 UTSW 9 78065044 missense possibly damaging 0.70
R2160:Gcm1 UTSW 9 78061380 missense probably benign 0.05
R3103:Gcm1 UTSW 9 78064452 missense probably damaging 0.98
R3944:Gcm1 UTSW 9 78059816 nonsense probably null
R5292:Gcm1 UTSW 9 78061426 missense probably damaging 1.00
R5769:Gcm1 UTSW 9 78064967 missense probably benign
R6446:Gcm1 UTSW 9 78059783 missense probably benign 0.08
R6465:Gcm1 UTSW 9 78064869 missense probably damaging 0.99
R7114:Gcm1 UTSW 9 78059779 missense probably damaging 1.00
R7212:Gcm1 UTSW 9 78059643 missense possibly damaging 0.84
R7584:Gcm1 UTSW 9 78064467 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- TTCCCCAAGAGTTATGATTTGGGG -3'
(R):5'- AGCTGCTCAGATCCACAGATAC -3'

Sequencing Primer
(F):5'- ATCTACGGCAGTGAAGAG -3'
(R):5'- ACAGATACTTTCTCTTCGTAAGGC -3'
Posted On2019-09-13