Incidental Mutation 'R7398:Dusp6'
ID573977
Institutional Source Beutler Lab
Gene Symbol Dusp6
Ensembl Gene ENSMUSG00000019960
Gene Namedual specificity phosphatase 6
SynonymsPYST1, MKP-3, 1300019I03Rik, MKP3
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.586) question?
Stock #R7398 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location99263231-99267489 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 99264878 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 245 (N245K)
Ref Sequence ENSEMBL: ENSMUSP00000020118 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020118] [ENSMUST00000220291]
Predicted Effect probably damaging
Transcript: ENSMUST00000020118
AA Change: N245K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000020118
Gene: ENSMUSG00000019960
AA Change: N245K

DomainStartEndE-ValueType
RHOD 20 145 3.06e-13 SMART
low complexity region 151 187 N/A INTRINSIC
DSPc 206 346 5.51e-65 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000220291
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mitogen-activated protein (MAP) kinase superfamily (MAPK/ERK, SAPK/JNK, p38), which are associated with cellular proliferation and differentiation. Different members of the family of dual specificity phosphatases show distinct substrate specificities for various MAP kinases, different tissue distribution and subcellular localization, and different modes of inducibility of their expression by extracellular stimuli. This gene product inactivates ERK2, is expressed in a variety of tissues with the highest levels in heart and pancreas, and unlike most other members of this family, is localized in the cytoplasm. Mutations in this gene have been associated with congenital hypogonadotropic hypogonadism. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous or heterozygous for a null mutation display partial penetrance of postnatal lethality, reduced body weight, and abnormal growth plate morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abl1 T A 2: 31,790,799 S368T probably damaging Het
Acmsd A G 1: 127,729,435 probably benign Het
Arid3b A T 9: 57,796,212 S445T probably benign Het
Brinp1 A G 4: 68,841,354 V91A probably benign Het
Ccne1 A G 7: 38,106,277 probably null Het
Col3a1 A T 1: 45,327,813 I249F unknown Het
Crybg3 T C 16: 59,557,325 I1189V probably benign Het
Cyp2d34 A T 15: 82,616,763 D389E probably benign Het
D130043K22Rik A C 13: 24,893,377 I998L probably damaging Het
Dgkq A G 5: 108,655,190 I298T possibly damaging Het
Dnah17 T C 11: 118,080,724 E2161G probably damaging Het
Dnajc25 T C 4: 59,017,824 probably null Het
Dpp9 G A 17: 56,189,405 R768* probably null Het
Dusp27 A G 1: 166,100,475 S523P probably damaging Het
E430018J23Rik C T 7: 127,393,324 C38Y probably null Het
Eea1 C A 10: 95,995,631 H195N probably benign Het
Efhc1 A G 1: 20,989,520 E598G probably benign Het
Epb41l1 T C 2: 156,534,762 V809A probably damaging Het
Gas8 T A 8: 123,518,951 M1K probably null Het
Gcm1 G A 9: 78,064,679 V301I probably benign Het
Gm11554 T A 11: 99,804,259 S43C unknown Het
Gm7298 A G 6: 121,781,953 I1177V probably benign Het
Gm8011 A G 14: 42,463,961 T27A Het
Hmcn1 A G 1: 150,646,670 I3493T probably benign Het
Insrr T G 3: 87,808,732 I578S probably damaging Het
Kif13b A G 14: 64,757,523 D908G probably null Het
Lhcgr G C 17: 88,772,046 Q71E probably benign Het
Lrrc34 T C 3: 30,643,342 D80G probably damaging Het
Lrrc7 C A 3: 158,291,958 E156* probably null Het
Lrrc9 A G 12: 72,500,816 D1255G probably damaging Het
Mcidas A G 13: 112,996,882 N116D probably benign Het
Mmp7 A G 9: 7,697,593 N210D probably damaging Het
Morc3 A G 16: 93,874,860 D926G probably damaging Het
Mrgpra9 A G 7: 47,235,637 I94T possibly damaging Het
Muc16 C A 9: 18,637,742 V5752F possibly damaging Het
Myo16 A T 8: 10,562,183 D1276V unknown Het
Nlrc4 T G 17: 74,446,542 E282A probably damaging Het
Nos2 T A 11: 78,936,471 Y227* probably null Het
Obox5 A C 7: 15,758,788 M223L probably benign Het
Olfr1337 C A 4: 118,781,699 L295F possibly damaging Het
Pygm G A 19: 6,385,936 R139H probably damaging Het
Ranbp2 C A 10: 58,467,277 P789T probably damaging Het
Riok2 T G 17: 17,387,239 S350A probably benign Het
Rnf214 C T 9: 45,867,547 V445I possibly damaging Het
Skida1 C T 2: 18,046,272 V603I unknown Het
Skint6 T A 4: 112,898,138 R747S probably benign Het
Slc24a5 G A 2: 125,085,774 W331* probably null Het
Slc5a10 A T 11: 61,673,579 C525S probably benign Het
Sult2b1 T C 7: 45,731,294 Y288C probably damaging Het
Tagln3 G T 16: 45,723,077 N67K probably damaging Het
Trav21-dv12 A T 14: 53,876,705 H94L probably benign Het
Tshz2 A G 2: 169,884,174 E230G probably damaging Het
Usb1 T A 8: 95,345,303 H210Q probably damaging Het
Vill C T 9: 119,070,648 P767L probably benign Het
Vmn2r94 A T 17: 18,257,341 N269K probably benign Het
Other mutations in Dusp6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02272:Dusp6 APN 10 99266019 missense probably damaging 1.00
IGL02687:Dusp6 APN 10 99266182 missense probably damaging 0.97
IGL02996:Dusp6 APN 10 99264766 missense possibly damaging 0.52
IGL03024:Dusp6 APN 10 99266294 missense probably damaging 0.97
R1134:Dusp6 UTSW 10 99264954 missense probably damaging 0.98
R1695:Dusp6 UTSW 10 99263693 start codon destroyed probably null 0.99
R2078:Dusp6 UTSW 10 99263824 missense probably damaging 1.00
R2899:Dusp6 UTSW 10 99263845 missense probably damaging 1.00
R3162:Dusp6 UTSW 10 99264082 missense probably damaging 1.00
R3162:Dusp6 UTSW 10 99264082 missense probably damaging 1.00
R4413:Dusp6 UTSW 10 99263924 missense probably damaging 1.00
R4501:Dusp6 UTSW 10 99264595 missense probably benign 0.41
R5175:Dusp6 UTSW 10 99264002 missense possibly damaging 0.91
R5381:Dusp6 UTSW 10 99266267 missense possibly damaging 0.46
R5560:Dusp6 UTSW 10 99266241 missense probably damaging 0.97
R5820:Dusp6 UTSW 10 99264002 missense possibly damaging 0.91
R7359:Dusp6 UTSW 10 99264065 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACTCTTCCTCGGACATTGAGTC -3'
(R):5'- AGACAGTAGAAGACCTGCAGTC -3'

Sequencing Primer
(F):5'- ATTGAGTCTGACCTTGACCGAGAC -3'
(R):5'- GCAGTCCAGCAAAACAGCCTG -3'
Posted On2019-09-13