Incidental Mutation 'R7398:Slc5a10'
ID573978
Institutional Source Beutler Lab
Gene Symbol Slc5a10
Ensembl Gene ENSMUSG00000042371
Gene Namesolute carrier family 5 (sodium/glucose cotransporter), member 10
SynonymsC330021F16Rik, SGLT5
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock #R7398 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location61672781-61720826 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 61673579 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 525 (C525S)
Ref Sequence ENSEMBL: ENSMUSP00000054407 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004959] [ENSMUST00000051552] [ENSMUST00000148584] [ENSMUST00000151780]
Predicted Effect probably benign
Transcript: ENSMUST00000004959
SMART Domains Protein: ENSMUSP00000004959
Gene: ENSMUSG00000004837

DomainStartEndE-ValueType
SH3 1 57 5.43e-18 SMART
SH2 58 141 1.9e-33 SMART
SH3 161 216 3.32e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000051552
AA Change: C525S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000054407
Gene: ENSMUSG00000042371
AA Change: C525S

DomainStartEndE-ValueType
Pfam:SSF 50 479 2.4e-139 PFAM
transmembrane domain 513 535 N/A INTRINSIC
transmembrane domain 576 595 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000148584
AA Change: C525S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000114523
Gene: ENSMUSG00000042371
AA Change: C525S

DomainStartEndE-ValueType
Pfam:SSF 50 479 2.4e-139 PFAM
transmembrane domain 513 535 N/A INTRINSIC
transmembrane domain 576 595 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151780
AA Change: C496S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000118196
Gene: ENSMUSG00000042371
AA Change: C496S

DomainStartEndE-ValueType
Pfam:SSF 48 185 3.5e-44 PFAM
Pfam:SSF 182 450 5e-79 PFAM
transmembrane domain 484 506 N/A INTRINSIC
transmembrane domain 547 566 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the sodium/glucose transporter family. Members of this family are sodium-dependent transporters and can be divided into two subfamilies based on sequence homology, one that co-transports sugars and the second that transports molecules such as ascorbate, choline, iodide, lipoate, monocaroboxylates, and pantothenate. The protein encoded by this gene has the highest affinity for mannose and has been reported to be most highly expressed in the kidney. This protein may function as a kidney-specific, sodium-dependent mannose and fructose co-transporter. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a targeted allele exhibit impaired fructose reabsorption in the kidneys and exacerbated hepatic steatosis induced by fructose. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abl1 T A 2: 31,790,799 S368T probably damaging Het
Acmsd A G 1: 127,729,435 probably benign Het
Arid3b A T 9: 57,796,212 S445T probably benign Het
Brinp1 A G 4: 68,841,354 V91A probably benign Het
Ccne1 A G 7: 38,106,277 probably null Het
Col3a1 A T 1: 45,327,813 I249F unknown Het
Crybg3 T C 16: 59,557,325 I1189V probably benign Het
Cyp2d34 A T 15: 82,616,763 D389E probably benign Het
D130043K22Rik A C 13: 24,893,377 I998L probably damaging Het
Dgkq A G 5: 108,655,190 I298T possibly damaging Het
Dnah17 T C 11: 118,080,724 E2161G probably damaging Het
Dnajc25 T C 4: 59,017,824 probably null Het
Dpp9 G A 17: 56,189,405 R768* probably null Het
Dusp27 A G 1: 166,100,475 S523P probably damaging Het
Dusp6 T A 10: 99,264,878 N245K probably damaging Het
E430018J23Rik C T 7: 127,393,324 C38Y probably null Het
Eea1 C A 10: 95,995,631 H195N probably benign Het
Efhc1 A G 1: 20,989,520 E598G probably benign Het
Epb41l1 T C 2: 156,534,762 V809A probably damaging Het
Gas8 T A 8: 123,518,951 M1K probably null Het
Gcm1 G A 9: 78,064,679 V301I probably benign Het
Gm11554 T A 11: 99,804,259 S43C unknown Het
Gm7298 A G 6: 121,781,953 I1177V probably benign Het
Gm8011 A G 14: 42,463,961 T27A Het
Hmcn1 A G 1: 150,646,670 I3493T probably benign Het
Insrr T G 3: 87,808,732 I578S probably damaging Het
Kif13b A G 14: 64,757,523 D908G probably null Het
Lhcgr G C 17: 88,772,046 Q71E probably benign Het
Lrrc34 T C 3: 30,643,342 D80G probably damaging Het
Lrrc7 C A 3: 158,291,958 E156* probably null Het
Lrrc9 A G 12: 72,500,816 D1255G probably damaging Het
Mcidas A G 13: 112,996,882 N116D probably benign Het
Mmp7 A G 9: 7,697,593 N210D probably damaging Het
Morc3 A G 16: 93,874,860 D926G probably damaging Het
Mrgpra9 A G 7: 47,235,637 I94T possibly damaging Het
Muc16 C A 9: 18,637,742 V5752F possibly damaging Het
Myo16 A T 8: 10,562,183 D1276V unknown Het
Nlrc4 T G 17: 74,446,542 E282A probably damaging Het
Nos2 T A 11: 78,936,471 Y227* probably null Het
Obox5 A C 7: 15,758,788 M223L probably benign Het
Olfr1337 C A 4: 118,781,699 L295F possibly damaging Het
Pygm G A 19: 6,385,936 R139H probably damaging Het
Ranbp2 C A 10: 58,467,277 P789T probably damaging Het
Riok2 T G 17: 17,387,239 S350A probably benign Het
Rnf214 C T 9: 45,867,547 V445I possibly damaging Het
Skida1 C T 2: 18,046,272 V603I unknown Het
Skint6 T A 4: 112,898,138 R747S probably benign Het
Slc24a5 G A 2: 125,085,774 W331* probably null Het
Sult2b1 T C 7: 45,731,294 Y288C probably damaging Het
Tagln3 G T 16: 45,723,077 N67K probably damaging Het
Trav21-dv12 A T 14: 53,876,705 H94L probably benign Het
Tshz2 A G 2: 169,884,174 E230G probably damaging Het
Usb1 T A 8: 95,345,303 H210Q probably damaging Het
Vill C T 9: 119,070,648 P767L probably benign Het
Vmn2r94 A T 17: 18,257,341 N269K probably benign Het
Other mutations in Slc5a10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01360:Slc5a10 APN 11 61715136 missense probably damaging 0.99
IGL02215:Slc5a10 APN 11 61673912 missense probably benign 0.00
IGL02354:Slc5a10 APN 11 61719840 critical splice donor site probably null
IGL02361:Slc5a10 APN 11 61719840 critical splice donor site probably null
IGL02573:Slc5a10 APN 11 61673072 missense possibly damaging 0.89
IGL02712:Slc5a10 APN 11 61707806 nonsense probably null
R1535:Slc5a10 UTSW 11 61673941 missense possibly damaging 0.65
R1659:Slc5a10 UTSW 11 61676244 missense possibly damaging 0.94
R1698:Slc5a10 UTSW 11 61709602 missense probably benign 0.44
R2161:Slc5a10 UTSW 11 61719934 missense probably null 0.17
R4948:Slc5a10 UTSW 11 61719882 missense probably damaging 0.98
R5686:Slc5a10 UTSW 11 61678566 missense probably benign 0.19
R5689:Slc5a10 UTSW 11 61707884 missense probably benign 0.16
R7769:Slc5a10 UTSW 11 61673647 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTAGGAGTCAACCGTGGGG -3'
(R):5'- GGTACTCCGCAAGTCCTTTG -3'

Sequencing Primer
(F):5'- GGTACCTGGCATCATAAAGGG -3'
(R):5'- GTACTCCGCAAGTCCTTTGAGATC -3'
Posted On2019-09-13