Mutagenetix > Incidental Mutations

Incidental Mutation 'R0625:Gfra4'

57398

Institutional Source

Beutler Lab

Gene Symbol

Gfra4

Ensembl Gene

ENSMUSG00000027316

Gene Name

glial cell line derived neurotrophic factor family receptor alpha 4

Synonyms

GFR alpha-4, G630015H18Rik

MMRRC Submission

038814-MU

Accession Numbers

Is this an essential gene?

Not available question?

Stock #

R0625 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

131039632-131043088 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 131040256 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 277 (V277I)

Ref Sequence

ENSEMBL: ENSMUSP00000028787 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028787] [ENSMUST00000028787] [ENSMUST00000066958] [ENSMUST00000110234] [ENSMUST00000110235] [ENSMUST00000110239] [ENSMUST00000110240]

Predicted Effect

probably null
Transcript: ENSMUST00000028787
AA Change: V277I

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000028787
Gene: ENSMUSG00000027316
AA Change: V277I

Domain	Start	End	E-Value	Type
GDNF	35	120	6.76e-17	SMART
GDNF	132	226	1.2e-31	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000028787
AA Change: V277I

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000028787
Gene: ENSMUSG00000027316
AA Change: V277I

Domain	Start	End	E-Value	Type
GDNF	35	120	6.76e-17	SMART
GDNF	132	226	1.2e-31	SMART

Predicted Effect

silent
Transcript: ENSMUST00000066958

SMART Domains

Protein: ENSMUSP00000068357
Gene: ENSMUSG00000027316

Domain	Start	End	E-Value	Type
GDNF	26	111	6.76e-17	SMART
GDNF	123	217	1.2e-31	SMART
low complexity region	248	260	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000110234

SMART Domains

Protein: ENSMUSP00000105863
Gene: ENSMUSG00000027316

Domain	Start	End	E-Value	Type
GDNF	35	120	6.76e-17	SMART
low complexity region	132	147	N/A	INTRINSIC
low complexity region	169	190	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000110235

SMART Domains

Protein: ENSMUSP00000105864
Gene: ENSMUSG00000027316

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
GDNF	26	111	6.76e-17	SMART
low complexity region	123	138	N/A	INTRINSIC
low complexity region	160	181	N/A	INTRINSIC

Predicted Effect

silent
Transcript: ENSMUST00000110239

SMART Domains

Protein: ENSMUSP00000105868
Gene: ENSMUSG00000027316

Domain	Start	End	E-Value	Type
GDNF	35	120	6.76e-17	SMART
GDNF	132	226	1.2e-31	SMART
low complexity region	257	269	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000110240
AA Change: V268I

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000105869
Gene: ENSMUSG00000027316
AA Change: V268I

Domain	Start	End	E-Value	Type
GDNF	26	111	6.76e-17	SMART
GDNF	123	217	1.2e-31	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136569

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156509

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000184185

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.5%
20x: 95.2%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a transmembrane protein that functions as the receptor for persephin, a member of the glial cell line derived neurotrophic factors. The encoded protein undergoes proteolytic processing to generate a glycosylphosphatidylinositol-anchored cell surface coreceptor that forms a complex with the receptor tyrosine kinase Ret. A complete lack of the encoded protein impairs production of thyroid calcitonin and increases the rate of bone formation in young mice. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygotes for targeted null mutations are mice were viable, fertile, showed no overt anatomical defects. Thyroid tissue calcitonin content was reduced in null homozygotes and rate of bone formation was enhanced when in 129/B6 hybrid background strain. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930550C14Rik	T	C	9: 53,408,065	S2P	probably benign	Het
Abca16	A	C	7: 120,435,893	T301P	probably damaging	Het
Acer2	A	G	4: 86,887,162	D121G	possibly damaging	Het
Adgrd1	T	C	5: 129,171,931		probably null	Het
Arhgap11a	T	C	2: 113,841,711	I249V	probably benign	Het
Arhgap22	A	G	14: 33,366,714	E219G	probably benign	Het
C2cd4b	T	A	9: 67,759,751	S10T	probably benign	Het
Cnot6	A	T	11: 49,683,171	I224N	probably damaging	Het
Ctrc	T	C	4: 141,841,518	T125A	probably damaging	Het
Cxxc5	T	G	18: 35,858,589	S14R	unknown	Het
Cyp4f37	T	G	17: 32,634,678	F445L	probably damaging	Het
Dcbld1	T	G	10: 52,312,850	I186S	probably benign	Het
Dmxl2	T	C	9: 54,382,702	T2510A	probably benign	Het
Dnah3	A	G	7: 120,071,887	I591T	possibly damaging	Het
Dock5	A	T	14: 67,841,163	I204N	probably benign	Het
Dysf	G	A	6: 84,111,987		probably null	Het
Erich5	A	G	15: 34,471,369	E248G	probably damaging	Het
Fam160a1	A	G	3: 85,730,500	V164A	possibly damaging	Het
Foxm1	A	G	6: 128,373,871	S712G	probably damaging	Het
Frmpd1	A	G	4: 45,284,055	T959A	probably benign	Het
Hacd4	T	C	4: 88,435,010	I82V	probably benign	Het
Itih2	C	T	2: 10,123,414	V159I	possibly damaging	Het
Itpr2	T	A	6: 146,166,651	M2410L	probably benign	Het
March11	A	G	15: 26,311,043	I202V	probably damaging	Het
March3	A	G	18: 56,811,830		probably null	Het
Med12l	G	A	3: 59,247,437	E1135K	probably damaging	Het
Mib2	C	T	4: 155,659,460	G42S	probably damaging	Het
Mlx	T	C	11: 101,087,782	L78P	possibly damaging	Het
Muc5b	T	C	7: 141,846,427	C473R	unknown	Het
N4bp2l1	T	A	5: 150,576,745	R66*	probably null	Het
Nes	A	G	3: 87,977,172	T913A	possibly damaging	Het
Oas1a	T	C	5: 120,899,259	E235G	probably damaging	Het
Olfr1104	T	A	2: 87,021,620	H308L	probably benign	Het
Olfr477	T	C	7: 107,991,189	S275P	probably damaging	Het
Olfr905	T	C	9: 38,473,208	S154P	possibly damaging	Het
Parn	C	T	16: 13,640,294	V286I	probably benign	Het
Paxip1	G	A	5: 27,765,942	Q470*	probably null	Het
Phc2	C	G	4: 128,723,710	H510D	possibly damaging	Het
Pla2g4f	T	A	2: 120,305,041	D384V	probably damaging	Het
Plpbp	A	T	8: 27,045,131	N68I	probably damaging	Het
Podxl2	G	A	6: 88,849,955	A123V	possibly damaging	Het
Pole	A	T	5: 110,325,550	T1737S	possibly damaging	Het
Ppp3cc	T	C	14: 70,225,027	E396G	probably damaging	Het
Pramel7	T	A	2: 87,491,008	I228F	probably benign	Het
Prl7d1	A	T	13: 27,710,140	C149S	probably benign	Het
Qtrt1	G	T	9: 21,418,288	M217I	probably benign	Het
Sec24a	T	A	11: 51,729,454	D456V	probably damaging	Het
Shox2	T	G	3: 66,981,544		probably null	Het
Skint2	T	A	4: 112,624,086	S49T	probably damaging	Het
Smarca5	A	G	8: 80,720,686		probably null	Het
Sorcs2	T	A	5: 36,024,572	D1068V	possibly damaging	Het
Tmem114	T	C	16: 8,412,102		probably null	Het
Ttc7b	T	A	12: 100,355,046	M24L	probably benign	Het
Ttll3	A	G	6: 113,408,903		probably null	Het
Usp7	C	T	16: 8,704,982	D102N	probably benign	Het

Other mutations in Gfra4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00800:Gfra4	APN	2	131040283	missense	possibly damaging	0.82
IGL02966:Gfra4	APN	2	131042640	missense	possibly damaging	0.73
R2285:Gfra4	UTSW	2	131041731	missense	probably damaging	1.00
R7233:Gfra4	UTSW	2	131041117	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- TTTCAGTCAGACCCTAGCCTCCAG -3'
(R):5'- TGACAGCTTGCAGCCATCAGTTC -3'

Sequencing Primer
(F):5'- AGCCCCCAATCCAGAGG -3'
(R):5'- CAGTTTCCGAATCCTTCCCA -3'

Posted On

2013-07-11