Incidental Mutation 'R7398:Lrrc9'
ID573982
Institutional Source Beutler Lab
Gene Symbol Lrrc9
Ensembl Gene ENSMUSG00000021090
Gene Nameleucine rich repeat containing 9
Synonyms4930432K16Rik, 4921529O18Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.193) question?
Stock #R7398 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location72441866-72530750 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 72500816 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1255 (D1255G)
Ref Sequence ENSEMBL: ENSMUSP00000124394 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000161284] [ENSMUST00000162159] [ENSMUST00000220791] [ENSMUST00000221360]
Predicted Effect probably benign
Transcript: ENSMUST00000161284
SMART Domains Protein: ENSMUSP00000124602
Gene: ENSMUSG00000021090

DomainStartEndE-ValueType
Pfam:LRR_4 77 118 2.8e-11 PFAM
LRR 119 140 8.49e1 SMART
LRR 141 164 2.27e1 SMART
LRR 165 187 2.09e2 SMART
LRRcap 210 228 6.12e1 SMART
low complexity region 373 384 N/A INTRINSIC
low complexity region 424 436 N/A INTRINSIC
LRR 706 727 1.41e2 SMART
LRR 728 749 6.78e1 SMART
LRR 750 773 7.17e1 SMART
LRRcap 793 811 2.26e2 SMART
LRR 943 966 2.67e-1 SMART
LRR 967 992 1.22e1 SMART
LRRcap 1031 1049 4.37e0 SMART
low complexity region 1109 1120 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000162159
AA Change: D1255G

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000124394
Gene: ENSMUSG00000021090
AA Change: D1255G

DomainStartEndE-ValueType
LRR 53 74 5.39e2 SMART
LRR 75 96 1.14e2 SMART
LRR 97 118 7.9e-4 SMART
LRR 119 140 2.75e-3 SMART
LRR 141 164 2.27e1 SMART
LRR 164 185 1.87e1 SMART
LRRcap 210 228 6.12e1 SMART
low complexity region 373 384 N/A INTRINSIC
low complexity region 424 436 N/A INTRINSIC
LRR 705 726 1.41e2 SMART
LRR 727 748 6.78e1 SMART
LRR 749 771 1.37e1 SMART
LRRcap 792 810 2.26e2 SMART
LRR 898 919 2.62e1 SMART
LRR 920 941 5.17e1 SMART
LRR 942 965 2.67e-1 SMART
LRR 966 991 1.22e1 SMART
LRR 1013 1032 4.42e2 SMART
LRRcap 1030 1048 4.37e0 SMART
low complexity region 1108 1119 N/A INTRINSIC
LRR 1128 1150 2.4e1 SMART
LRR 1191 1209 5.7e2 SMART
LRR 1215 1236 1.03e-2 SMART
LRR 1237 1260 8.48e0 SMART
LRR 1283 1304 2.67e-1 SMART
Blast:LRR 1308 1333 4e-6 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000220791
AA Change: D169G

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000221360
AA Change: D1256G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abl1 T A 2: 31,790,799 S368T probably damaging Het
Acmsd A G 1: 127,729,435 probably benign Het
Arid3b A T 9: 57,796,212 S445T probably benign Het
Brinp1 A G 4: 68,841,354 V91A probably benign Het
Ccne1 A G 7: 38,106,277 probably null Het
Col3a1 A T 1: 45,327,813 I249F unknown Het
Crybg3 T C 16: 59,557,325 I1189V probably benign Het
Cyp2d34 A T 15: 82,616,763 D389E probably benign Het
D130043K22Rik A C 13: 24,893,377 I998L probably damaging Het
Dgkq A G 5: 108,655,190 I298T possibly damaging Het
Dnah17 T C 11: 118,080,724 E2161G probably damaging Het
Dnajc25 T C 4: 59,017,824 probably null Het
Dpp9 G A 17: 56,189,405 R768* probably null Het
Dusp27 A G 1: 166,100,475 S523P probably damaging Het
Dusp6 T A 10: 99,264,878 N245K probably damaging Het
E430018J23Rik C T 7: 127,393,324 C38Y probably null Het
Eea1 C A 10: 95,995,631 H195N probably benign Het
Efhc1 A G 1: 20,989,520 E598G probably benign Het
Epb41l1 T C 2: 156,534,762 V809A probably damaging Het
Gas8 T A 8: 123,518,951 M1K probably null Het
Gcm1 G A 9: 78,064,679 V301I probably benign Het
Gm11554 T A 11: 99,804,259 S43C unknown Het
Gm7298 A G 6: 121,781,953 I1177V probably benign Het
Gm8011 A G 14: 42,463,961 T27A Het
Hmcn1 A G 1: 150,646,670 I3493T probably benign Het
Insrr T G 3: 87,808,732 I578S probably damaging Het
Kif13b A G 14: 64,757,523 D908G probably null Het
Lhcgr G C 17: 88,772,046 Q71E probably benign Het
Lrrc34 T C 3: 30,643,342 D80G probably damaging Het
Lrrc7 C A 3: 158,291,958 E156* probably null Het
Mcidas A G 13: 112,996,882 N116D probably benign Het
Mmp7 A G 9: 7,697,593 N210D probably damaging Het
Morc3 A G 16: 93,874,860 D926G probably damaging Het
Mrgpra9 A G 7: 47,235,637 I94T possibly damaging Het
Muc16 C A 9: 18,637,742 V5752F possibly damaging Het
Myo16 A T 8: 10,562,183 D1276V unknown Het
Nlrc4 T G 17: 74,446,542 E282A probably damaging Het
Nos2 T A 11: 78,936,471 Y227* probably null Het
Obox5 A C 7: 15,758,788 M223L probably benign Het
Olfr1337 C A 4: 118,781,699 L295F possibly damaging Het
Pygm G A 19: 6,385,936 R139H probably damaging Het
Ranbp2 C A 10: 58,467,277 P789T probably damaging Het
Riok2 T G 17: 17,387,239 S350A probably benign Het
Rnf214 C T 9: 45,867,547 V445I possibly damaging Het
Skida1 C T 2: 18,046,272 V603I unknown Het
Skint6 T A 4: 112,898,138 R747S probably benign Het
Slc24a5 G A 2: 125,085,774 W331* probably null Het
Slc5a10 A T 11: 61,673,579 C525S probably benign Het
Sult2b1 T C 7: 45,731,294 Y288C probably damaging Het
Tagln3 G T 16: 45,723,077 N67K probably damaging Het
Trav21-dv12 A T 14: 53,876,705 H94L probably benign Het
Tshz2 A G 2: 169,884,174 E230G probably damaging Het
Usb1 T A 8: 95,345,303 H210Q probably damaging Het
Vill C T 9: 119,070,648 P767L probably benign Het
Vmn2r94 A T 17: 18,257,341 N269K probably benign Het
Other mutations in Lrrc9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Lrrc9 APN 12 72486243 missense possibly damaging 0.63
IGL00843:Lrrc9 APN 12 72463417 missense possibly damaging 0.78
IGL01923:Lrrc9 APN 12 72510412 missense possibly damaging 0.93
IGL02027:Lrrc9 APN 12 72470334 splice site probably benign
IGL02271:Lrrc9 APN 12 72510381 missense probably benign 0.06
IGL02398:Lrrc9 APN 12 72466903 missense probably benign
IGL02795:Lrrc9 APN 12 72478768 missense probably damaging 1.00
IGL02931:Lrrc9 APN 12 72454149 missense probably damaging 1.00
IGL03257:Lrrc9 APN 12 72449768 missense probably benign
IGL02799:Lrrc9 UTSW 12 72506404 missense probably damaging 1.00
R0172:Lrrc9 UTSW 12 72463486 missense possibly damaging 0.50
R0315:Lrrc9 UTSW 12 72456028 missense probably damaging 0.96
R0492:Lrrc9 UTSW 12 72478763 missense possibly damaging 0.47
R0617:Lrrc9 UTSW 12 72483014 missense probably damaging 1.00
R0639:Lrrc9 UTSW 12 72486288 missense probably damaging 1.00
R0987:Lrrc9 UTSW 12 72510382 missense probably benign 0.00
R1325:Lrrc9 UTSW 12 72497104 missense probably damaging 0.99
R1465:Lrrc9 UTSW 12 72500759 missense probably benign 0.05
R1465:Lrrc9 UTSW 12 72500759 missense probably benign 0.05
R1479:Lrrc9 UTSW 12 72460825 nonsense probably null
R1564:Lrrc9 UTSW 12 72487053 missense probably damaging 1.00
R1626:Lrrc9 UTSW 12 72495661 unclassified probably null
R1632:Lrrc9 UTSW 12 72460020 splice site probably null
R1715:Lrrc9 UTSW 12 72477299 missense probably damaging 1.00
R1743:Lrrc9 UTSW 12 72456117 missense probably damaging 1.00
R1779:Lrrc9 UTSW 12 72455998 nonsense probably null
R1866:Lrrc9 UTSW 12 72497138 missense probably damaging 0.97
R1878:Lrrc9 UTSW 12 72476164 critical splice donor site probably null
R1990:Lrrc9 UTSW 12 72497861 missense probably damaging 0.99
R2361:Lrrc9 UTSW 12 72463470 missense possibly damaging 0.52
R3752:Lrrc9 UTSW 12 72460806 nonsense probably null
R3833:Lrrc9 UTSW 12 72482991 missense probably damaging 1.00
R4134:Lrrc9 UTSW 12 72466966 missense probably benign 0.00
R4651:Lrrc9 UTSW 12 72477386 missense probably damaging 1.00
R4652:Lrrc9 UTSW 12 72477386 missense probably damaging 1.00
R4659:Lrrc9 UTSW 12 72470264 missense probably damaging 1.00
R4831:Lrrc9 UTSW 12 72499679 missense probably damaging 1.00
R4857:Lrrc9 UTSW 12 72499692 missense possibly damaging 0.94
R5017:Lrrc9 UTSW 12 72506325 missense possibly damaging 0.86
R5163:Lrrc9 UTSW 12 72449389 missense probably damaging 1.00
R5279:Lrrc9 UTSW 12 72495594 missense possibly damaging 0.80
R5434:Lrrc9 UTSW 12 72454088 missense probably damaging 0.98
R5783:Lrrc9 UTSW 12 72456053 missense possibly damaging 0.62
R6021:Lrrc9 UTSW 12 72469231 missense probably damaging 0.97
R6214:Lrrc9 UTSW 12 72459853 missense probably damaging 1.00
R6255:Lrrc9 UTSW 12 72487023 missense probably benign 0.33
R6538:Lrrc9 UTSW 12 72500929 missense probably benign 0.08
R6563:Lrrc9 UTSW 12 72486395 splice site probably null
R6672:Lrrc9 UTSW 12 72473936 missense possibly damaging 0.88
R6919:Lrrc9 UTSW 12 72506393 missense probably benign 0.01
R6929:Lrrc9 UTSW 12 72450772 missense probably benign 0.41
R7092:Lrrc9 UTSW 12 72463464 missense possibly damaging 0.81
R7150:Lrrc9 UTSW 12 72466952 missense probably benign 0.00
R7338:Lrrc9 UTSW 12 72463531 intron probably null
R7477:Lrrc9 UTSW 12 72503527 critical splice donor site probably null
R7501:Lrrc9 UTSW 12 72449716 missense probably damaging 1.00
R7542:Lrrc9 UTSW 12 72506320 missense probably damaging 0.96
R7816:Lrrc9 UTSW 12 72495692 missense probably damaging 1.00
R7870:Lrrc9 UTSW 12 72486190 missense probably damaging 0.99
R7953:Lrrc9 UTSW 12 72486190 missense probably damaging 0.99
R8042:Lrrc9 UTSW 12 72460906 missense not run
X0025:Lrrc9 UTSW 12 72497060 missense probably damaging 1.00
Z1176:Lrrc9 UTSW 12 72477393 missense not run
Predicted Primers PCR Primer
(F):5'- CAGTTTGTGCTACGGTTGAGAC -3'
(R):5'- GCCTGTGACATGCCGATAAAG -3'

Sequencing Primer
(F):5'- TTGTGCTACGGTTGAGACATAAAAG -3'
(R):5'- TGACATGCCGATAAAGAGCTATAAAC -3'
Posted On2019-09-13