Mutagenetix > Incidental Mutation

Incidental Mutation 'R7399:Malrd1'

574000

Institutional Source

Beutler Lab

Gene Symbol

Malrd1

Ensembl Gene

ENSMUSG00000075520

Gene Name

MAM and LDL receptor class A domain containing 1

Synonyms

Diet1, Gm13364, Gm13318

MMRRC Submission

045481-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.076) question?

Stock #

R7399 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

15526479-16255555 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 15610090 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Asparagine at position 239 (D239N)

Ref Sequence

ENSEMBL: ENSMUSP00000116869 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000146205]

AlphaFold

A2AJX4

Predicted Effect

SMART Domains

Protein: ENSMUSP00000116869
Gene: ENSMUSG00000075520
AA Change: D239N

Domain	Start	End	E-Value	Type
Pfam:MAM	8	171	1.6e-36	PFAM
LDLa	181	219	6.89e-8	SMART
LDLa	225	262	4.37e-10	SMART
LDLa	264	303	9.55e-3	SMART

Meta Mutation Damage Score

0.0852

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

99% (74/75)

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acaca	T	G	11: 84,260,679	V801G	possibly damaging	Het
Actbl2	T	A	13: 111,255,593	M154K	probably benign	Het
Adam7	A	T	14: 68,504,466		probably null	Het
Arfgef1	T	A	1: 10,180,897	T888S	probably benign	Het
AW554918	C	T	18: 25,169,060	P10L	possibly damaging	Het
Bcap29	A	G	12: 31,630,882	I35T	probably damaging	Het
Bhlhe40	TG	TGG	6: 108,664,857	254	probably null	Het
C87499	C	A	4: 88,627,965	R380L	probably benign	Het
Cdc25b	A	G	2: 131,194,654	D458G	probably damaging	Het
Cdc42bpb	T	C	12: 111,305,667	K1104R	probably benign	Het
Cep89	A	G	7: 35,438,378	N729S	probably damaging	Het
Clec4a4	T	A	6: 122,991,829	M51K	possibly damaging	Het
Dcdc2b	A	G	4: 129,609,629	L270P	probably damaging	Het
Dennd5b	G	T	6: 149,036,483	H639N	probably damaging	Het
Dnah11	T	C	12: 118,125,785	E1182G	probably damaging	Het
Dnah11	T	G	12: 118,027,477	T2385P	probably benign	Het
Dok7	T	C	5: 35,066,471	V81A	probably damaging	Het
Dtx1	T	A	5: 120,682,393	M494L	possibly damaging	Het
Foxj1	A	T	11: 116,332,254	L241Q	possibly damaging	Het
Gbp10	G	A	5: 105,236,149		probably benign	Het
Hnmt	T	A	2: 24,003,880	T201S	probably benign	Het
Jup	G	T	11: 100,378,351	T412K	possibly damaging	Het
Kcnh2	G	A	5: 24,322,059	S954F	probably damaging	Het
Klhdc7b	A	C	15: 89,388,644	K585T	possibly damaging	Het
Klk7	T	A	7: 43,812,000	S14T	probably benign	Het
Lama4	G	A	10: 39,047,948	E451K	probably damaging	Het
Ldhb	A	G	6: 142,495,673	C164R	probably damaging	Het
Mgam	T	A	6: 40,666,854	V572E	probably damaging	Het
Mrgprb2	G	T	7: 48,552,142	N278K	probably damaging	Het
Msto1	A	G	3: 88,911,823	Y206H	probably damaging	Het
Myo6	A	G	9: 80,262,291	S467G	unknown	Het
Mysm1	T	A	4: 94,961,727	I447L	probably benign	Het
Nav3	T	C	10: 109,852,934	E494G	possibly damaging	Het
Nol10	T	G	12: 17,402,173	V376G	probably damaging	Het
Nup205	T	A	6: 35,214,676	I1032N	probably damaging	Het
Olfr1002	T	A	2: 85,647,424	D299V	possibly damaging	Het
Olfr1100	G	A	2: 86,978,157	T213I	probably benign	Het
Olfr1170	A	T	2: 88,225,022	Y3*	probably null	Het
Olfr1450	A	G	19: 12,954,447	N286S	probably damaging	Het
Olfr449	T	G	6: 42,838,746	Y288*	probably null	Het
Olfr455	A	G	6: 42,538,728	F98S	possibly damaging	Het
Olfr617	A	T	7: 103,584,381	I120L	possibly damaging	Het
Olfr782	A	T	10: 129,350,557		probably benign	Het
Olfr996	A	G	2: 85,579,296	D19G	probably benign	Het
Oog2	A	G	4: 144,195,281	K254E	probably benign	Het
Osbpl11	T	A	16: 33,236,279	D694E	probably benign	Het
Pcm1	T	A	8: 41,293,510	Y1210N	probably benign	Het
Pdxk	T	C	10: 78,440,863	M293V	probably benign	Het
Plcb3	T	C	19: 6,962,867	I451V	probably benign	Het
Plekhm2	A	G	4: 141,634,376	F272S	probably damaging	Het
Ptgdr	A	T	14: 44,858,232		probably null	Het
Ptprf	C	T	4: 118,226,523	V788I	probably benign	Het
Ralbp1	C	T	17: 65,854,148	V467I	probably benign	Het
Ralgds	A	C	2: 28,543,655	Q229P	possibly damaging	Het
Recql	T	C	6: 142,374,884	D146G	probably damaging	Het
Reln	T	C	5: 22,051,367	N493S	probably damaging	Het
Rfxank	C	T	8: 70,135,286		probably null	Het
Scn5a	A	T	9: 119,486,530	M1704K	probably damaging	Het
Slc7a7	G	T	14: 54,374,268	A316E	possibly damaging	Het
Slco1a6	A	T	6: 142,091,068	C538S	probably benign	Het
Spert	A	G	14: 75,592,637	S39P	probably benign	Het
Stard6	T	C	18: 70,498,647		probably null	Het
Strip2	T	A	6: 29,927,613	M219K	possibly damaging	Het
Tcam1	T	C	11: 106,284,085	V122A	probably damaging	Het
Tha1	A	G	11: 117,869,690	V236A	possibly damaging	Het
Tmem201	A	T	4: 149,731,097	I132N	possibly damaging	Het
Tnc	T	C	4: 64,020,657		probably benign	Het
Vmn1r42	T	C	6: 89,845,513	T25A	probably benign	Het
Vmn2r94	T	A	17: 18,244,503		probably null	Het
Wdfy4	A	C	14: 33,068,906	V2188G		Het
Zfp623	T	C	15: 75,947,398	S68P	probably damaging	Het
Zfp950	A	T	19: 61,119,155	C497S	probably damaging	Het
Zkscan2	C	T	7: 123,480,104	E877K	probably damaging	Het
Zp3r	C	A	1: 130,577,053	V536L	probably damaging	Het

Other mutations in Malrd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00498:Malrd1	APN	2	16142186	splice site	probably benign
IGL01295:Malrd1	APN	2	16101957	critical splice donor site	probably null
IGL01296:Malrd1	APN	2	16101957	critical splice donor site	probably null
IGL01399:Malrd1	APN	2	16101957	critical splice donor site	probably null
IGL01400:Malrd1	APN	2	16101957	critical splice donor site	probably null
IGL01401:Malrd1	APN	2	16101957	critical splice donor site	probably null
IGL01402:Malrd1	APN	2	16101957	critical splice donor site	probably null
IGL01405:Malrd1	APN	2	16101957	critical splice donor site	probably null
IGL01406:Malrd1	APN	2	16101957	critical splice donor site	probably null
IGL02105:Malrd1	APN	2	16127863	missense	unknown
IGL02581:Malrd1	APN	2	16142312	nonsense	probably null
IGL03015:Malrd1	APN	2	16042271	missense	unknown
IGL03038:Malrd1	APN	2	16127967	missense	unknown
R1353:Malrd1	UTSW	2	16127968	missense	unknown
R1385:Malrd1	UTSW	2	16042228	missense	unknown
R2242:Malrd1	UTSW	2	16101944	missense	unknown
R2888:Malrd1	UTSW	2	16074757	missense	unknown
R4398:Malrd1	UTSW	2	16150783	missense	unknown
R4982:Malrd1	UTSW	2	16042129	missense	probably benign	0.29
R5148:Malrd1	UTSW	2	16142226	missense	unknown
R5195:Malrd1	UTSW	2	16150810	missense	unknown
R5828:Malrd1	UTSW	2	15526653	missense	probably benign	0.00
R5892:Malrd1	UTSW	2	15614267	missense	probably benign	0.03
R6034:Malrd1	UTSW	2	15845326	missense	possibly damaging	0.78
R6034:Malrd1	UTSW	2	15845326	missense	possibly damaging	0.78
R6195:Malrd1	UTSW	2	15695326	missense	probably damaging	1.00
R6318:Malrd1	UTSW	2	16042267	missense	unknown
R6438:Malrd1	UTSW	2	15614206	missense
R6457:Malrd1	UTSW	2	15526597	start gained	probably benign
R6457:Malrd1	UTSW	2	15667929	missense	probably benign	0.41
R6499:Malrd1	UTSW	2	15931689	missense	probably benign	0.03
R6575:Malrd1	UTSW	2	15842628	missense	probably benign	0.00
R6792:Malrd1	UTSW	2	16150756	missense	unknown
R6796:Malrd1	UTSW	2	15869784	missense	unknown
R6930:Malrd1	UTSW	2	15797667	missense	unknown
R6959:Malrd1	UTSW	2	16218009	missense	probably damaging	0.97
R6993:Malrd1	UTSW	2	16150791	missense	unknown
R7102:Malrd1	UTSW	2	16142303	missense	unknown
R7112:Malrd1	UTSW	2	15925176	missense	unknown
R7248:Malrd1	UTSW	2	16101911	missense	unknown
R7249:Malrd1	UTSW	2	15623340	missense	probably damaging	0.97
R7334:Malrd1	UTSW	2	16006718	missense	probably damaging	0.99
R7394:Malrd1	UTSW	2	15695199	missense	unknown
R7476:Malrd1	UTSW	2	16142304	missense	unknown
R7582:Malrd1	UTSW	2	15695270	missense	unknown
R7604:Malrd1	UTSW	2	15925192	missense	unknown
R7662:Malrd1	UTSW	2	15871454	missense	unknown
R7681:Malrd1	UTSW	2	16218102	missense	unknown
R7740:Malrd1	UTSW	2	15614215	missense	not run
R7747:Malrd1	UTSW	2	16074835	missense	unknown
R7754:Malrd1	UTSW	2	15797799	splice site	probably null
R7950:Malrd1	UTSW	2	16128068	missense	unknown
R8194:Malrd1	UTSW	2	15925120	missense	unknown
R8260:Malrd1	UTSW	2	15614206	missense
R8314:Malrd1	UTSW	2	15752832	missense	unknown
R8342:Malrd1	UTSW	2	15633224	missense	unknown
R8386:Malrd1	UTSW	2	15696844	missense	unknown
R8492:Malrd1	UTSW	2	15610123	missense
R8728:Malrd1	UTSW	2	15696942	nonsense	probably null
R8756:Malrd1	UTSW	2	15752895	critical splice donor site	probably null
R8869:Malrd1	UTSW	2	15565557	critical splice donor site	probably null
R8888:Malrd1	UTSW	2	15845227	missense	unknown
R8895:Malrd1	UTSW	2	15845227	missense	unknown
R8902:Malrd1	UTSW	2	16255334	nonsense	probably null
R8954:Malrd1	UTSW	2	15551367	missense
R8960:Malrd1	UTSW	2	15565430	nonsense	probably null
R9005:Malrd1	UTSW	2	15845329	missense	unknown
R9135:Malrd1	UTSW	2	15797705	missense	unknown
R9267:Malrd1	UTSW	2	16255266	missense	unknown
R9330:Malrd1	UTSW	2	16255278	missense	unknown
R9359:Malrd1	UTSW	2	15614177	missense
R9383:Malrd1	UTSW	2	15695201	missense	unknown
R9389:Malrd1	UTSW	2	15703156	missense	unknown
R9403:Malrd1	UTSW	2	15614177	missense
R9454:Malrd1	UTSW	2	15752849	missense	unknown
R9454:Malrd1	UTSW	2	15797726	nonsense	probably null
R9520:Malrd1	UTSW	2	16074820	missense	unknown
R9544:Malrd1	UTSW	2	15635998	missense	unknown
R9609:Malrd1	UTSW	2	15695270	missense	unknown
R9667:Malrd1	UTSW	2	15565215	critical splice acceptor site	probably null
R9721:Malrd1	UTSW	2	15696827	missense	unknown
R9787:Malrd1	UTSW	2	15620590	missense	unknown
R9800:Malrd1	UTSW	2	15842594	missense	unknown
Z1176:Malrd1	UTSW	2	16217845	missense	unknown
Z1191:Malrd1	UTSW	2	16042226	missense	unknown

Predicted Primers

PCR Primer
(F):5'- CCTGTTAGGATCCAAAGCTTTATTG -3'
(R):5'- TATCAACACCCCTGGCTTAAAG -3'

Sequencing Primer
(F):5'- GGTTAAGCAGGCACTCTA -3'
(R):5'- CCCTGGCTTAAAGACTTAATGC -3'

Posted On

2019-09-13