Incidental Mutation 'R7399:Ralgds'
ID574002
Institutional Source Beutler Lab
Gene Symbol Ralgds
Ensembl Gene ENSMUSG00000026821
Gene Nameral guanine nucleotide dissociation stimulator
SynonymsRalGDS, Gnds, Rgds
Accession Numbers

Ncbi RefSeq: NM_001145835.1, NM_001145836.1, NM_009058.2, NM_001145834.1; MGI:107485

Is this an essential gene? Probably non essential (E-score: 0.206) question?
Stock #R7399 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location28513125-28553081 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 28543655 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Proline at position 229 (Q229P)
Ref Sequence ENSEMBL: ENSMUSP00000097812 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028170] [ENSMUST00000100241] [ENSMUST00000113893] [ENSMUST00000135803]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028170
AA Change: Q174P

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000028170
Gene: ENSMUSG00000026821
AA Change: Q174P

DomainStartEndE-ValueType
RasGEFN 56 194 4.02e-37 SMART
low complexity region 239 285 N/A INTRINSIC
RasGEF 320 587 5.28e-118 SMART
low complexity region 613 626 N/A INTRINSIC
low complexity region 646 655 N/A INTRINSIC
low complexity region 683 712 N/A INTRINSIC
low complexity region 716 726 N/A INTRINSIC
RA 736 823 6.51e-22 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000100241
AA Change: Q229P

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000097812
Gene: ENSMUSG00000026821
AA Change: Q229P

DomainStartEndE-ValueType
RasGEFN 111 249 4.02e-37 SMART
low complexity region 294 340 N/A INTRINSIC
RasGEF 375 642 5.28e-118 SMART
low complexity region 668 681 N/A INTRINSIC
low complexity region 701 710 N/A INTRINSIC
low complexity region 738 767 N/A INTRINSIC
low complexity region 771 781 N/A INTRINSIC
RA 791 878 6.51e-22 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000113893
AA Change: Q217P

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000109526
Gene: ENSMUSG00000026821
AA Change: Q217P

DomainStartEndE-ValueType
RasGEFN 111 237 1.25e-42 SMART
low complexity region 282 328 N/A INTRINSIC
RasGEF 363 630 5.28e-118 SMART
low complexity region 656 669 N/A INTRINSIC
low complexity region 689 698 N/A INTRINSIC
low complexity region 726 755 N/A INTRINSIC
low complexity region 759 769 N/A INTRINSIC
RA 779 866 6.51e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135803
SMART Domains Protein: ENSMUSP00000115092
Gene: ENSMUSG00000026821

DomainStartEndE-ValueType
RasGEFN 56 127 2.47e-3 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000116215
Gene: ENSMUSG00000026821
AA Change: S76R

DomainStartEndE-ValueType
RasGEFN 1 107 5.55e-8 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (74/75)
MGI Phenotype Strain: 3574574
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Guanine nucleotide dissociation stimulators (GDSs, or exchange factors), such as RALGDS, are effectors of Ras-related GTPases (see MIM 190020) that participate in signaling for a variety of cellular processes.[supplied by OMIM, Nov 2010]
PHENOTYPE: Homozygous mutant mice exhibit reduced tumor incidence, size and progression to malignancy in multistage skin carcinogenesis. [provided by MGI curators]
Allele List at MGI

All alleles(16) : Targeted(5) Gene trapped(11)

Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T G 11: 84,260,679 V801G possibly damaging Het
Actbl2 T A 13: 111,255,593 M154K probably benign Het
Adam7 A T 14: 68,504,466 probably null Het
Arfgef1 T A 1: 10,180,897 T888S probably benign Het
AW554918 C T 18: 25,169,060 P10L possibly damaging Het
Bcap29 A G 12: 31,630,882 I35T probably damaging Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
C87499 C A 4: 88,627,965 R380L probably benign Het
Cdc25b A G 2: 131,194,654 D458G probably damaging Het
Cdc42bpb T C 12: 111,305,667 K1104R probably benign Het
Cep89 A G 7: 35,438,378 N729S probably damaging Het
Clec4a4 T A 6: 122,991,829 M51K possibly damaging Het
Dcdc2b A G 4: 129,609,629 L270P probably damaging Het
Dennd5b G T 6: 149,036,483 H639N probably damaging Het
Dnah11 T G 12: 118,027,477 T2385P probably benign Het
Dnah11 T C 12: 118,125,785 E1182G probably damaging Het
Dok7 T C 5: 35,066,471 V81A probably damaging Het
Dtx1 T A 5: 120,682,393 M494L possibly damaging Het
Foxj1 A T 11: 116,332,254 L241Q possibly damaging Het
Gbp10 G A 5: 105,236,149 probably benign Het
Hnmt T A 2: 24,003,880 T201S probably benign Het
Jup G T 11: 100,378,351 T412K possibly damaging Het
Kcnh2 G A 5: 24,322,059 S954F probably damaging Het
Klhdc7b A C 15: 89,388,644 K585T possibly damaging Het
Klk7 T A 7: 43,812,000 S14T probably benign Het
Lama4 G A 10: 39,047,948 E451K probably damaging Het
Ldhb A G 6: 142,495,673 C164R probably damaging Het
Malrd1 G A 2: 15,610,090 D239N Het
Mgam T A 6: 40,666,854 V572E probably damaging Het
Mrgprb2 G T 7: 48,552,142 N278K probably damaging Het
Msto1 A G 3: 88,911,823 Y206H probably damaging Het
Myo6 A G 9: 80,262,291 S467G unknown Het
Mysm1 T A 4: 94,961,727 I447L probably benign Het
Nav3 T C 10: 109,852,934 E494G possibly damaging Het
Nol10 T G 12: 17,402,173 V376G probably damaging Het
Nup205 T A 6: 35,214,676 I1032N probably damaging Het
Olfr1002 T A 2: 85,647,424 D299V possibly damaging Het
Olfr1100 G A 2: 86,978,157 T213I probably benign Het
Olfr1170 A T 2: 88,225,022 Y3* probably null Het
Olfr1450 A G 19: 12,954,447 N286S probably damaging Het
Olfr449 T G 6: 42,838,746 Y288* probably null Het
Olfr455 A G 6: 42,538,728 F98S possibly damaging Het
Olfr617 A T 7: 103,584,381 I120L possibly damaging Het
Olfr782 A T 10: 129,350,557 probably benign Het
Olfr996 A G 2: 85,579,296 D19G probably benign Het
Oog2 A G 4: 144,195,281 K254E probably benign Het
Osbpl11 T A 16: 33,236,279 D694E probably benign Het
Pcm1 T A 8: 41,293,510 Y1210N probably benign Het
Pdxk T C 10: 78,440,863 M293V probably benign Het
Plcb3 T C 19: 6,962,867 I451V probably benign Het
Plekhm2 A G 4: 141,634,376 F272S probably damaging Het
Ptgdr A T 14: 44,858,232 probably null Het
Ptprf C T 4: 118,226,523 V788I probably benign Het
Ralbp1 C T 17: 65,854,148 V467I probably benign Het
Recql T C 6: 142,374,884 D146G probably damaging Het
Reln T C 5: 22,051,367 N493S probably damaging Het
Rfxank C T 8: 70,135,286 probably null Het
Scn5a A T 9: 119,486,530 M1704K probably damaging Het
Slc7a7 G T 14: 54,374,268 A316E possibly damaging Het
Slco1a6 A T 6: 142,091,068 C538S probably benign Het
Spert A G 14: 75,592,637 S39P probably benign Het
Stard6 T C 18: 70,498,647 probably null Het
Strip2 T A 6: 29,927,613 M219K possibly damaging Het
Tcam1 T C 11: 106,284,085 V122A probably damaging Het
Tha1 A G 11: 117,869,690 V236A possibly damaging Het
Tmem201 A T 4: 149,731,097 I132N possibly damaging Het
Tnc T C 4: 64,020,657 probably benign Het
Vmn1r42 T C 6: 89,845,513 T25A probably benign Het
Vmn2r94 T A 17: 18,244,503 probably null Het
Wdfy4 A C 14: 33,068,906 V2188G Het
Zfp623 T C 15: 75,947,398 S68P probably damaging Het
Zfp950 A T 19: 61,119,155 C497S probably damaging Het
Zkscan2 C T 7: 123,480,104 E877K probably damaging Het
Zp3r C A 1: 130,577,053 V536L probably damaging Het
Other mutations in Ralgds
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00426:Ralgds APN 2 28552218 missense probably damaging 1.00
IGL01774:Ralgds APN 2 28550542 nonsense probably null
IGL02747:Ralgds APN 2 28548110 unclassified probably benign
IGL03135:Ralgds APN 2 28549088 missense probably damaging 0.99
PIT4458001:Ralgds UTSW 2 28542474 missense probably damaging 1.00
PIT4531001:Ralgds UTSW 2 28545214 nonsense probably null
R0049:Ralgds UTSW 2 28542379 synonymous silent
R0052:Ralgds UTSW 2 28544388 critical splice donor site probably null
R0052:Ralgds UTSW 2 28544388 critical splice donor site probably null
R0285:Ralgds UTSW 2 28550569 splice site probably null
R0665:Ralgds UTSW 2 28545206 missense probably damaging 0.98
R0718:Ralgds UTSW 2 28549116 missense probably benign 0.37
R1755:Ralgds UTSW 2 28550546 missense probably damaging 0.99
R1966:Ralgds UTSW 2 28545875 missense probably damaging 0.96
R2873:Ralgds UTSW 2 28548769 splice site probably null
R2874:Ralgds UTSW 2 28548769 splice site probably null
R4082:Ralgds UTSW 2 28552271 utr 3 prime probably benign
R4342:Ralgds UTSW 2 28552095 missense probably damaging 1.00
R4344:Ralgds UTSW 2 28552095 missense probably damaging 1.00
R4647:Ralgds UTSW 2 28545520 critical splice donor site probably null
R4738:Ralgds UTSW 2 28545416 missense probably damaging 1.00
R4762:Ralgds UTSW 2 28552152 missense probably damaging 0.97
R5027:Ralgds UTSW 2 28552090 critical splice acceptor site probably null
R5320:Ralgds UTSW 2 28545212 missense probably damaging 1.00
R5738:Ralgds UTSW 2 28542526 intron probably benign
R5969:Ralgds UTSW 2 28542414 missense probably damaging 1.00
R6014:Ralgds UTSW 2 28543661 missense probably damaging 0.97
R6136:Ralgds UTSW 2 28550565 critical splice donor site probably null
R6137:Ralgds UTSW 2 28547588 missense probably damaging 0.99
R6583:Ralgds UTSW 2 28533644 missense probably damaging 0.99
R6618:Ralgds UTSW 2 28550511 missense probably benign 0.09
R6801:Ralgds UTSW 2 28548436 missense probably damaging 1.00
R7046:Ralgds UTSW 2 28540729 missense probably damaging 1.00
R7095:Ralgds UTSW 2 28549308 missense possibly damaging 0.83
R7276:Ralgds UTSW 2 28545872 missense probably damaging 1.00
R7446:Ralgds UTSW 2 28545889 missense probably damaging 0.99
R7560:Ralgds UTSW 2 28547595 missense probably damaging 1.00
X0028:Ralgds UTSW 2 28548699 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGTCTAGTTACTTGGACAGCC -3'
(R):5'- ACAAGATGGTATCCCAGACTCTG -3'

Sequencing Primer
(F):5'- ACTTGTGGGTGGAGGCACAC -3'
(R):5'- GGTGTACTACCTACTGGGCC -3'
Posted On2019-09-13