Incidental Mutation 'R7399:Or5d41'
ID 574006
Institutional Source Beutler Lab
Gene Symbol Or5d41
Ensembl Gene ENSMUSG00000075133
Gene Name olfactory receptor family 5 subfamily D member 41
Synonyms Olfr1170, MOR174-12, GA_x6K02T2Q125-49709783-49708833
MMRRC Submission 045481-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.054) question?
Stock # R7399 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 88054424-88055374 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 88055366 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 3 (Y3*)
Ref Sequence ENSEMBL: ENSMUSP00000150142 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099831] [ENSMUST00000214386]
AlphaFold Q8VFG1
Predicted Effect probably null
Transcript: ENSMUST00000099831
AA Change: Y3*
SMART Domains Protein: ENSMUSP00000097419
Gene: ENSMUSG00000075133
AA Change: Y3*

DomainStartEndE-ValueType
Pfam:7tm_4 33 310 1.2e-49 PFAM
Pfam:7tm_1 43 292 4.4e-15 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000214386
AA Change: Y3*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T G 11: 84,151,505 (GRCm39) V801G possibly damaging Het
Actbl2 T A 13: 111,392,127 (GRCm39) M154K probably benign Het
Adam7 A T 14: 68,741,915 (GRCm39) probably null Het
Arfgef1 T A 1: 10,251,122 (GRCm39) T888S probably benign Het
AW554918 C T 18: 25,302,117 (GRCm39) P10L possibly damaging Het
Bcap29 A G 12: 31,680,881 (GRCm39) I35T probably damaging Het
Bhlhe40 TG TGG 6: 108,641,818 (GRCm39) 254 probably null Het
Cby2 A G 14: 75,830,077 (GRCm39) S39P probably benign Het
Cdc25b A G 2: 131,036,574 (GRCm39) D458G probably damaging Het
Cdc42bpb T C 12: 111,272,101 (GRCm39) K1104R probably benign Het
Cep89 A G 7: 35,137,803 (GRCm39) N729S probably damaging Het
Clec4a4 T A 6: 122,968,788 (GRCm39) M51K possibly damaging Het
Dcdc2b A G 4: 129,503,422 (GRCm39) L270P probably damaging Het
Dennd5b G T 6: 148,937,981 (GRCm39) H639N probably damaging Het
Dnah11 T G 12: 117,991,212 (GRCm39) T2385P probably benign Het
Dnah11 T C 12: 118,089,520 (GRCm39) E1182G probably damaging Het
Dok7 T C 5: 35,223,815 (GRCm39) V81A probably damaging Het
Dtx1 T A 5: 120,820,458 (GRCm39) M494L possibly damaging Het
Foxj1 A T 11: 116,223,080 (GRCm39) L241Q possibly damaging Het
Gbp10 G A 5: 105,384,015 (GRCm39) probably benign Het
Hnmt T A 2: 23,893,892 (GRCm39) T201S probably benign Het
Jup G T 11: 100,269,177 (GRCm39) T412K possibly damaging Het
Kcnh2 G A 5: 24,527,057 (GRCm39) S954F probably damaging Het
Klhdc7b A C 15: 89,272,847 (GRCm39) K585T possibly damaging Het
Klk7 T A 7: 43,461,424 (GRCm39) S14T probably benign Het
Lama4 G A 10: 38,923,944 (GRCm39) E451K probably damaging Het
Ldhb A G 6: 142,441,399 (GRCm39) C164R probably damaging Het
Malrd1 G A 2: 15,614,901 (GRCm39) D239N Het
Mgam T A 6: 40,643,788 (GRCm39) V572E probably damaging Het
Mrgprb2 G T 7: 48,201,890 (GRCm39) N278K probably damaging Het
Msto1 A G 3: 88,819,130 (GRCm39) Y206H probably damaging Het
Myo6 A G 9: 80,169,573 (GRCm39) S467G unknown Het
Mysm1 T A 4: 94,849,964 (GRCm39) I447L probably benign Het
Nav3 T C 10: 109,688,795 (GRCm39) E494G possibly damaging Het
Nol10 T G 12: 17,452,174 (GRCm39) V376G probably damaging Het
Nup205 T A 6: 35,191,611 (GRCm39) I1032N probably damaging Het
Oog2 A G 4: 143,921,851 (GRCm39) K254E probably benign Het
Or10ac1 A G 6: 42,515,662 (GRCm39) F98S possibly damaging Het
Or52z12 A T 7: 103,233,588 (GRCm39) I120L possibly damaging Het
Or5b98 A G 19: 12,931,811 (GRCm39) N286S probably damaging Het
Or5g25 T A 2: 85,477,768 (GRCm39) D299V possibly damaging Het
Or5g27 A G 2: 85,409,640 (GRCm39) D19G probably benign Het
Or6b1 T G 6: 42,815,680 (GRCm39) Y288* probably null Het
Or6c6 A T 10: 129,186,426 (GRCm39) probably benign Het
Or8h10 G A 2: 86,808,501 (GRCm39) T213I probably benign Het
Osbpl11 T A 16: 33,056,649 (GRCm39) D694E probably benign Het
Pcm1 T A 8: 41,746,547 (GRCm39) Y1210N probably benign Het
Pdxk T C 10: 78,276,697 (GRCm39) M293V probably benign Het
Plcb3 T C 19: 6,940,235 (GRCm39) I451V probably benign Het
Plekhm2 A G 4: 141,361,687 (GRCm39) F272S probably damaging Het
Pramel32 C A 4: 88,546,202 (GRCm39) R380L probably benign Het
Ptgdr A T 14: 45,095,689 (GRCm39) probably null Het
Ptprf C T 4: 118,083,720 (GRCm39) V788I probably benign Het
Ralbp1 C T 17: 66,161,143 (GRCm39) V467I probably benign Het
Ralgds A C 2: 28,433,667 (GRCm39) Q229P possibly damaging Het
Recql T C 6: 142,320,610 (GRCm39) D146G probably damaging Het
Reln T C 5: 22,256,365 (GRCm39) N493S probably damaging Het
Rfxank C T 8: 70,587,936 (GRCm39) probably null Het
Scn5a A T 9: 119,315,596 (GRCm39) M1704K probably damaging Het
Slc7a7 G T 14: 54,611,725 (GRCm39) A316E possibly damaging Het
Slco1a6 A T 6: 142,036,794 (GRCm39) C538S probably benign Het
Stard6 T C 18: 70,631,718 (GRCm39) probably null Het
Strip2 T A 6: 29,927,612 (GRCm39) M219K possibly damaging Het
Tcam1 T C 11: 106,174,911 (GRCm39) V122A probably damaging Het
Tha1 A G 11: 117,760,516 (GRCm39) V236A possibly damaging Het
Tmem201 A T 4: 149,815,554 (GRCm39) I132N possibly damaging Het
Tnc T C 4: 63,938,894 (GRCm39) probably benign Het
Vmn1r42 T C 6: 89,822,495 (GRCm39) T25A probably benign Het
Vmn2r94 T A 17: 18,464,765 (GRCm39) probably null Het
Wdfy4 A C 14: 32,790,863 (GRCm39) V2188G Het
Zfp623 T C 15: 75,819,247 (GRCm39) S68P probably damaging Het
Zfp950 A T 19: 61,107,593 (GRCm39) C497S probably damaging Het
Zkscan2 C T 7: 123,079,327 (GRCm39) E877K probably damaging Het
Zp3r C A 1: 130,504,790 (GRCm39) V536L probably damaging Het
Other mutations in Or5d41
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0184:Or5d41 UTSW 2 88,055,124 (GRCm39) nonsense probably null
R0496:Or5d41 UTSW 2 88,054,499 (GRCm39) nonsense probably null
R0558:Or5d41 UTSW 2 88,054,818 (GRCm39) missense possibly damaging 0.50
R2067:Or5d41 UTSW 2 88,054,818 (GRCm39) missense possibly damaging 0.50
R2111:Or5d41 UTSW 2 88,054,818 (GRCm39) missense possibly damaging 0.50
R2273:Or5d41 UTSW 2 88,055,167 (GRCm39) missense probably benign 0.03
R2274:Or5d41 UTSW 2 88,055,167 (GRCm39) missense probably benign 0.03
R2275:Or5d41 UTSW 2 88,055,167 (GRCm39) missense probably benign 0.03
R5924:Or5d41 UTSW 2 88,054,891 (GRCm39) missense probably benign
R5942:Or5d41 UTSW 2 88,054,916 (GRCm39) missense probably benign 0.03
R6487:Or5d41 UTSW 2 88,054,870 (GRCm39) missense possibly damaging 0.80
R7776:Or5d41 UTSW 2 88,054,429 (GRCm39) missense probably damaging 0.99
R7961:Or5d41 UTSW 2 88,055,033 (GRCm39) missense possibly damaging 0.91
X0022:Or5d41 UTSW 2 88,055,325 (GRCm39) missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- TCAAGATCTGCAAAAGTTTGGG -3'
(R):5'- ACTGCCCACGTAAGAACCTG -3'

Sequencing Primer
(F):5'- CTGCAAAAGTTTGGGTGTAAATACAC -3'
(R):5'- GAACCTGTAACAAGGGCAAATATTC -3'
Posted On 2019-09-13