Incidental Mutation 'R7399:Msto1'
ID574008
Institutional Source Beutler Lab
Gene Symbol Msto1
Ensembl Gene ENSMUSG00000068922
Gene Namemisato 1, mitochondrial distribution and morphology regulator
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.898) question?
Stock #R7399 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location88905107-88913999 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 88911823 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 206 (Y206H)
Ref Sequence ENSEMBL: ENSMUSP00000103118 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081695] [ENSMUST00000090942] [ENSMUST00000107494] [ENSMUST00000107498] [ENSMUST00000126245]
Predicted Effect probably benign
Transcript: ENSMUST00000081695
SMART Domains Protein: ENSMUSP00000080397
Gene: ENSMUSG00000054199

DomainStartEndE-ValueType
low complexity region 16 29 N/A INTRINSIC
low complexity region 104 115 N/A INTRINSIC
low complexity region 150 163 N/A INTRINSIC
low complexity region 240 256 N/A INTRINSIC
low complexity region 348 377 N/A INTRINSIC
low complexity region 432 439 N/A INTRINSIC
low complexity region 527 542 N/A INTRINSIC
low complexity region 683 696 N/A INTRINSIC
Blast:SANT 813 865 1e-23 BLAST
low complexity region 961 975 N/A INTRINSIC
low complexity region 1311 1329 N/A INTRINSIC
low complexity region 1418 1434 N/A INTRINSIC
low complexity region 1452 1497 N/A INTRINSIC
low complexity region 1507 1541 N/A INTRINSIC
Pfam:PAH 1652 1700 8.8e-9 PFAM
low complexity region 1800 1811 N/A INTRINSIC
coiled coil region 1919 1943 N/A INTRINSIC
low complexity region 2085 2094 N/A INTRINSIC
SANT 2153 2204 2.2e-1 SMART
low complexity region 2207 2222 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000090942
SMART Domains Protein: ENSMUSP00000088461
Gene: ENSMUSG00000054199

DomainStartEndE-ValueType
low complexity region 16 29 N/A INTRINSIC
low complexity region 104 115 N/A INTRINSIC
low complexity region 150 163 N/A INTRINSIC
low complexity region 241 257 N/A INTRINSIC
low complexity region 349 378 N/A INTRINSIC
low complexity region 433 440 N/A INTRINSIC
low complexity region 528 543 N/A INTRINSIC
low complexity region 684 697 N/A INTRINSIC
Blast:SANT 814 866 2e-23 BLAST
low complexity region 962 976 N/A INTRINSIC
low complexity region 1312 1330 N/A INTRINSIC
low complexity region 1419 1435 N/A INTRINSIC
low complexity region 1453 1498 N/A INTRINSIC
low complexity region 1508 1542 N/A INTRINSIC
Pfam:PAH 1654 1700 2.1e-8 PFAM
low complexity region 1801 1812 N/A INTRINSIC
coiled coil region 1920 1944 N/A INTRINSIC
low complexity region 2086 2095 N/A INTRINSIC
SANT 2154 2205 2.2e-1 SMART
low complexity region 2208 2223 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107494
AA Change: Y206H

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000103118
Gene: ENSMUSG00000068922
AA Change: Y206H

DomainStartEndE-ValueType
low complexity region 50 63 N/A INTRINSIC
Pfam:Tubulin_3 153 345 5.3e-28 PFAM
Pfam:Tubulin 169 300 7.3e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107498
SMART Domains Protein: ENSMUSP00000103122
Gene: ENSMUSG00000054199

DomainStartEndE-ValueType
low complexity region 16 29 N/A INTRINSIC
low complexity region 104 115 N/A INTRINSIC
low complexity region 150 163 N/A INTRINSIC
low complexity region 240 256 N/A INTRINSIC
low complexity region 348 377 N/A INTRINSIC
low complexity region 432 439 N/A INTRINSIC
low complexity region 527 542 N/A INTRINSIC
low complexity region 683 696 N/A INTRINSIC
Blast:SANT 813 865 1e-23 BLAST
low complexity region 961 975 N/A INTRINSIC
low complexity region 1311 1329 N/A INTRINSIC
low complexity region 1418 1434 N/A INTRINSIC
low complexity region 1452 1497 N/A INTRINSIC
low complexity region 1507 1541 N/A INTRINSIC
Pfam:PAH 1652 1700 8.8e-9 PFAM
low complexity region 1800 1811 N/A INTRINSIC
coiled coil region 1919 1943 N/A INTRINSIC
low complexity region 2085 2094 N/A INTRINSIC
SANT 2153 2204 2.2e-1 SMART
low complexity region 2207 2222 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000126245
AA Change: Y193H

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000115645
Gene: ENSMUSG00000068922
AA Change: Y193H

DomainStartEndE-ValueType
Pfam:Misat_Tub_SegII 6 120 2.1e-36 PFAM
Pfam:Tubulin_3 140 332 1.9e-27 PFAM
Pfam:Tubulin 151 288 8.7e-12 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (74/75)
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T G 11: 84,260,679 V801G possibly damaging Het
Actbl2 T A 13: 111,255,593 M154K probably benign Het
Adam7 A T 14: 68,504,466 probably null Het
Arfgef1 T A 1: 10,180,897 T888S probably benign Het
AW554918 C T 18: 25,169,060 P10L possibly damaging Het
Bcap29 A G 12: 31,630,882 I35T probably damaging Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
C87499 C A 4: 88,627,965 R380L probably benign Het
Cdc25b A G 2: 131,194,654 D458G probably damaging Het
Cdc42bpb T C 12: 111,305,667 K1104R probably benign Het
Cep89 A G 7: 35,438,378 N729S probably damaging Het
Clec4a4 T A 6: 122,991,829 M51K possibly damaging Het
Dcdc2b A G 4: 129,609,629 L270P probably damaging Het
Dennd5b G T 6: 149,036,483 H639N probably damaging Het
Dnah11 T G 12: 118,027,477 T2385P probably benign Het
Dnah11 T C 12: 118,125,785 E1182G probably damaging Het
Dok7 T C 5: 35,066,471 V81A probably damaging Het
Dtx1 T A 5: 120,682,393 M494L possibly damaging Het
Foxj1 A T 11: 116,332,254 L241Q possibly damaging Het
Gbp10 G A 5: 105,236,149 probably benign Het
Hnmt T A 2: 24,003,880 T201S probably benign Het
Jup G T 11: 100,378,351 T412K possibly damaging Het
Kcnh2 G A 5: 24,322,059 S954F probably damaging Het
Klhdc7b A C 15: 89,388,644 K585T possibly damaging Het
Klk7 T A 7: 43,812,000 S14T probably benign Het
Lama4 G A 10: 39,047,948 E451K probably damaging Het
Ldhb A G 6: 142,495,673 C164R probably damaging Het
Malrd1 G A 2: 15,610,090 D239N Het
Mgam T A 6: 40,666,854 V572E probably damaging Het
Mrgprb2 G T 7: 48,552,142 N278K probably damaging Het
Myo6 A G 9: 80,262,291 S467G unknown Het
Mysm1 T A 4: 94,961,727 I447L probably benign Het
Nav3 T C 10: 109,852,934 E494G possibly damaging Het
Nol10 T G 12: 17,402,173 V376G probably damaging Het
Nup205 T A 6: 35,214,676 I1032N probably damaging Het
Olfr1002 T A 2: 85,647,424 D299V possibly damaging Het
Olfr1100 G A 2: 86,978,157 T213I probably benign Het
Olfr1170 A T 2: 88,225,022 Y3* probably null Het
Olfr1450 A G 19: 12,954,447 N286S probably damaging Het
Olfr449 T G 6: 42,838,746 Y288* probably null Het
Olfr455 A G 6: 42,538,728 F98S possibly damaging Het
Olfr617 A T 7: 103,584,381 I120L possibly damaging Het
Olfr782 A T 10: 129,350,557 probably benign Het
Olfr996 A G 2: 85,579,296 D19G probably benign Het
Oog2 A G 4: 144,195,281 K254E probably benign Het
Osbpl11 T A 16: 33,236,279 D694E probably benign Het
Pcm1 T A 8: 41,293,510 Y1210N probably benign Het
Pdxk T C 10: 78,440,863 M293V probably benign Het
Plcb3 T C 19: 6,962,867 I451V probably benign Het
Plekhm2 A G 4: 141,634,376 F272S probably damaging Het
Ptgdr A T 14: 44,858,232 probably null Het
Ptprf C T 4: 118,226,523 V788I probably benign Het
Ralbp1 C T 17: 65,854,148 V467I probably benign Het
Ralgds A C 2: 28,543,655 Q229P possibly damaging Het
Recql T C 6: 142,374,884 D146G probably damaging Het
Reln T C 5: 22,051,367 N493S probably damaging Het
Rfxank C T 8: 70,135,286 probably null Het
Scn5a A T 9: 119,486,530 M1704K probably damaging Het
Slc7a7 G T 14: 54,374,268 A316E possibly damaging Het
Slco1a6 A T 6: 142,091,068 C538S probably benign Het
Spert A G 14: 75,592,637 S39P probably benign Het
Stard6 T C 18: 70,498,647 probably null Het
Strip2 T A 6: 29,927,613 M219K possibly damaging Het
Tcam1 T C 11: 106,284,085 V122A probably damaging Het
Tha1 A G 11: 117,869,690 V236A possibly damaging Het
Tmem201 A T 4: 149,731,097 I132N possibly damaging Het
Tnc T C 4: 64,020,657 probably benign Het
Vmn1r42 T C 6: 89,845,513 T25A probably benign Het
Vmn2r94 T A 17: 18,244,503 probably null Het
Wdfy4 A C 14: 33,068,906 V2188G Het
Zfp623 T C 15: 75,947,398 S68P probably damaging Het
Zfp950 A T 19: 61,119,155 C497S probably damaging Het
Zkscan2 C T 7: 123,480,104 E877K probably damaging Het
Zp3r C A 1: 130,577,053 V536L probably damaging Het
Other mutations in Msto1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01307:Msto1 APN 3 88913686 missense probably benign 0.12
IGL01309:Msto1 APN 3 88913686 missense probably benign 0.12
IGL01327:Msto1 APN 3 88910632 splice site probably null
IGL01505:Msto1 APN 3 88910743 missense probably benign 0.00
IGL01914:Msto1 APN 3 88912903 missense probably benign 0.39
IGL02292:Msto1 APN 3 88911824 missense probably benign 0.20
IGL02349:Msto1 APN 3 88910898 missense possibly damaging 0.95
IGL02510:Msto1 APN 3 88910345 missense probably damaging 1.00
IGL03120:Msto1 APN 3 88910809 missense probably damaging 1.00
R0041:Msto1 UTSW 3 88910235 missense probably damaging 0.97
R0110:Msto1 UTSW 3 88911541 missense probably benign 0.02
R0282:Msto1 UTSW 3 88911577 missense possibly damaging 0.91
R0384:Msto1 UTSW 3 88910339 nonsense probably null
R0450:Msto1 UTSW 3 88911541 missense probably benign 0.02
R0469:Msto1 UTSW 3 88911541 missense probably benign 0.02
R0510:Msto1 UTSW 3 88911541 missense probably benign 0.02
R2088:Msto1 UTSW 3 88910990 missense probably damaging 1.00
R2516:Msto1 UTSW 3 88911893 splice site probably null
R4897:Msto1 UTSW 3 88912252 missense probably benign 0.02
R5661:Msto1 UTSW 3 88912885 missense possibly damaging 0.66
R6179:Msto1 UTSW 3 88910947 missense probably damaging 1.00
R6326:Msto1 UTSW 3 88912098 missense probably damaging 1.00
R6395:Msto1 UTSW 3 88905474 missense possibly damaging 0.77
R7039:Msto1 UTSW 3 88911390 missense probably damaging 0.96
R7557:Msto1 UTSW 3 88910128 critical splice donor site probably null
R7583:Msto1 UTSW 3 88912929 critical splice acceptor site probably null
R7620:Msto1 UTSW 3 88911307 missense possibly damaging 0.87
R7993:Msto1 UTSW 3 88910174 missense probably benign 0.17
R8015:Msto1 UTSW 3 88911556 missense probably damaging 1.00
R8235:Msto1 UTSW 3 88912921 missense probably damaging 1.00
R8693:Msto1 UTSW 3 88911877 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AGTAGCTCTGCAGTTTTAGCAC -3'
(R):5'- TGAGGCAAAGCTTAGGTCAC -3'

Sequencing Primer
(F):5'- GCAGTTTTAGCACCTACTCCAGAG -3'
(R):5'- TTAGGTCACCCCAACACTGG -3'
Posted On2019-09-13