Incidental Mutation 'R7399:Mysm1'
ID574011
Institutional Source Beutler Lab
Gene Symbol Mysm1
Ensembl Gene ENSMUSG00000062627
Gene Namemyb-like, SWIRM and MPN domains 1
SynonymsC130067A03Rik, C530050H10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.898) question?
Stock #R7399 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location94942040-94979100 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 94961727 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 447 (I447L)
Ref Sequence ENSEMBL: ENSMUSP00000075269 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075872]
Predicted Effect probably benign
Transcript: ENSMUST00000075872
AA Change: I447L

PolyPhen 2 Score 0.290 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000075269
Gene: ENSMUSG00000062627
AA Change: I447L

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
SANT 114 162 3.24e-13 SMART
low complexity region 214 229 N/A INTRINSIC
Pfam:SWIRM 365 452 3.1e-22 PFAM
JAB_MPN 569 691 1.63e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (74/75)
MGI Phenotype PHENOTYPE: Homozygotes exhibit pigmentation, epidermis, hair follicle and hair cycle abnormalities. Abnormalities in behavior, the hematopoietic and immune systems, body size, metabolism, and skeletal and eye phenotypes are also seen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T G 11: 84,260,679 V801G possibly damaging Het
Actbl2 T A 13: 111,255,593 M154K probably benign Het
Adam7 A T 14: 68,504,466 probably null Het
Arfgef1 T A 1: 10,180,897 T888S probably benign Het
AW554918 C T 18: 25,169,060 P10L possibly damaging Het
Bcap29 A G 12: 31,630,882 I35T probably damaging Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
C87499 C A 4: 88,627,965 R380L probably benign Het
Cdc25b A G 2: 131,194,654 D458G probably damaging Het
Cdc42bpb T C 12: 111,305,667 K1104R probably benign Het
Cep89 A G 7: 35,438,378 N729S probably damaging Het
Clec4a4 T A 6: 122,991,829 M51K possibly damaging Het
Dcdc2b A G 4: 129,609,629 L270P probably damaging Het
Dennd5b G T 6: 149,036,483 H639N probably damaging Het
Dnah11 T G 12: 118,027,477 T2385P probably benign Het
Dnah11 T C 12: 118,125,785 E1182G probably damaging Het
Dok7 T C 5: 35,066,471 V81A probably damaging Het
Dtx1 T A 5: 120,682,393 M494L possibly damaging Het
Foxj1 A T 11: 116,332,254 L241Q possibly damaging Het
Gbp10 G A 5: 105,236,149 probably benign Het
Hnmt T A 2: 24,003,880 T201S probably benign Het
Jup G T 11: 100,378,351 T412K possibly damaging Het
Kcnh2 G A 5: 24,322,059 S954F probably damaging Het
Klhdc7b A C 15: 89,388,644 K585T possibly damaging Het
Klk7 T A 7: 43,812,000 S14T probably benign Het
Lama4 G A 10: 39,047,948 E451K probably damaging Het
Ldhb A G 6: 142,495,673 C164R probably damaging Het
Malrd1 G A 2: 15,610,090 D239N Het
Mgam T A 6: 40,666,854 V572E probably damaging Het
Mrgprb2 G T 7: 48,552,142 N278K probably damaging Het
Msto1 A G 3: 88,911,823 Y206H probably damaging Het
Myo6 A G 9: 80,262,291 S467G unknown Het
Nav3 T C 10: 109,852,934 E494G possibly damaging Het
Nol10 T G 12: 17,402,173 V376G probably damaging Het
Nup205 T A 6: 35,214,676 I1032N probably damaging Het
Olfr1002 T A 2: 85,647,424 D299V possibly damaging Het
Olfr1100 G A 2: 86,978,157 T213I probably benign Het
Olfr1170 A T 2: 88,225,022 Y3* probably null Het
Olfr1450 A G 19: 12,954,447 N286S probably damaging Het
Olfr449 T G 6: 42,838,746 Y288* probably null Het
Olfr455 A G 6: 42,538,728 F98S possibly damaging Het
Olfr617 A T 7: 103,584,381 I120L possibly damaging Het
Olfr782 A T 10: 129,350,557 probably benign Het
Olfr996 A G 2: 85,579,296 D19G probably benign Het
Oog2 A G 4: 144,195,281 K254E probably benign Het
Osbpl11 T A 16: 33,236,279 D694E probably benign Het
Pcm1 T A 8: 41,293,510 Y1210N probably benign Het
Pdxk T C 10: 78,440,863 M293V probably benign Het
Plcb3 T C 19: 6,962,867 I451V probably benign Het
Plekhm2 A G 4: 141,634,376 F272S probably damaging Het
Ptgdr A T 14: 44,858,232 probably null Het
Ptprf C T 4: 118,226,523 V788I probably benign Het
Ralbp1 C T 17: 65,854,148 V467I probably benign Het
Ralgds A C 2: 28,543,655 Q229P possibly damaging Het
Recql T C 6: 142,374,884 D146G probably damaging Het
Reln T C 5: 22,051,367 N493S probably damaging Het
Rfxank C T 8: 70,135,286 probably null Het
Scn5a A T 9: 119,486,530 M1704K probably damaging Het
Slc7a7 G T 14: 54,374,268 A316E possibly damaging Het
Slco1a6 A T 6: 142,091,068 C538S probably benign Het
Spert A G 14: 75,592,637 S39P probably benign Het
Stard6 T C 18: 70,498,647 probably null Het
Strip2 T A 6: 29,927,613 M219K possibly damaging Het
Tcam1 T C 11: 106,284,085 V122A probably damaging Het
Tha1 A G 11: 117,869,690 V236A possibly damaging Het
Tmem201 A T 4: 149,731,097 I132N possibly damaging Het
Tnc T C 4: 64,020,657 probably benign Het
Vmn1r42 T C 6: 89,845,513 T25A probably benign Het
Vmn2r94 T A 17: 18,244,503 probably null Het
Wdfy4 A C 14: 33,068,906 V2188G Het
Zfp623 T C 15: 75,947,398 S68P probably damaging Het
Zfp950 A T 19: 61,119,155 C497S probably damaging Het
Zkscan2 C T 7: 123,480,104 E877K probably damaging Het
Zp3r C A 1: 130,577,053 V536L probably damaging Het
Other mutations in Mysm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00424:Mysm1 APN 4 94972909 splice site probably benign
IGL00657:Mysm1 APN 4 94960365 missense probably benign 0.17
IGL00908:Mysm1 APN 4 94958935 missense probably damaging 1.00
IGL01095:Mysm1 APN 4 94967869 critical splice donor site probably null
IGL02454:Mysm1 APN 4 94970504 splice site probably benign
IGL02544:Mysm1 APN 4 94952306 missense probably damaging 1.00
IGL02815:Mysm1 APN 4 94957048 critical splice donor site probably null
IGL02966:Mysm1 APN 4 94975286 missense probably benign 0.31
IGL03273:Mysm1 APN 4 94965718 missense probably damaging 1.00
R1746:Mysm1 UTSW 4 94948411 nonsense probably null
R1826:Mysm1 UTSW 4 94970686 missense probably benign 0.01
R1980:Mysm1 UTSW 4 94952213 missense probably benign 0.27
R3424:Mysm1 UTSW 4 94965321 missense probably benign 0.05
R3700:Mysm1 UTSW 4 94970652 missense probably benign 0.04
R4243:Mysm1 UTSW 4 94969011 missense probably benign 0.15
R4798:Mysm1 UTSW 4 94965673 missense probably benign 0.00
R4884:Mysm1 UTSW 4 94958948 missense probably damaging 0.98
R4983:Mysm1 UTSW 4 94972970 missense probably benign 0.01
R5024:Mysm1 UTSW 4 94951016 missense possibly damaging 0.47
R5213:Mysm1 UTSW 4 94948377 missense probably damaging 0.96
R5758:Mysm1 UTSW 4 94952361 missense probably damaging 0.98
R6129:Mysm1 UTSW 4 94967955 missense probably damaging 1.00
R7535:Mysm1 UTSW 4 94952215 missense probably benign 0.01
R7793:Mysm1 UTSW 4 94965132 missense probably damaging 0.99
R7861:Mysm1 UTSW 4 94946967 makesense probably null
R7923:Mysm1 UTSW 4 94961765 missense probably damaging 1.00
R8117:Mysm1 UTSW 4 94960390 nonsense probably null
R8352:Mysm1 UTSW 4 94975273 missense probably damaging 0.97
R8389:Mysm1 UTSW 4 94965612 missense probably benign 0.00
R8452:Mysm1 UTSW 4 94975273 missense probably damaging 0.97
R8738:Mysm1 UTSW 4 94967959 missense probably damaging 1.00
X0021:Mysm1 UTSW 4 94975225 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCGTCTCAACTCGTATTTGTAAAG -3'
(R):5'- GGGCTTAGTTTTGGGGAAAGAATAC -3'

Sequencing Primer
(F):5'- AACTCGTATTTGTAAAGTAAACATGC -3'
(R):5'- TTGGGGAAAGAATACTTGTAACAC -3'
Posted On2019-09-13