Incidental Mutation 'R7399:Dcdc2b'
ID 574013
Institutional Source Beutler Lab
Gene Symbol Dcdc2b
Ensembl Gene ENSMUSG00000078552
Gene Name doublecortin domain containing 2b
Synonyms Gm12964, LOC384062
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7399 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 129608331-129614257 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 129609629 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 270 (L270P)
Ref Sequence ENSEMBL: ENSMUSP00000101653 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102591] [ENSMUST00000106037] [ENSMUST00000129515] [ENSMUST00000135628] [ENSMUST00000137090] [ENSMUST00000150110] [ENSMUST00000151969] [ENSMUST00000152126] [ENSMUST00000172774] [ENSMUST00000173758] [ENSMUST00000173937] [ENSMUST00000174073] [ENSMUST00000174819] [ENSMUST00000179209] [ENSMUST00000181579]
AlphaFold J3KML0
Predicted Effect probably benign
Transcript: ENSMUST00000102591
SMART Domains Protein: ENSMUSP00000099651
Gene: ENSMUSG00000028797

DomainStartEndE-ValueType
Pfam:TMEM234 11 126 2.1e-46 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106037
AA Change: L270P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000101653
Gene: ENSMUSG00000078552
AA Change: L270P

DomainStartEndE-ValueType
DCX 1 85 7.69e-26 SMART
DCX 118 205 6.22e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129515
SMART Domains Protein: ENSMUSP00000117184
Gene: ENSMUSG00000028797

DomainStartEndE-ValueType
Pfam:UPF0546 11 62 1.1e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135628
SMART Domains Protein: ENSMUSP00000120682
Gene: ENSMUSG00000028797

DomainStartEndE-ValueType
Pfam:UPF0546 11 62 1.1e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137090
SMART Domains Protein: ENSMUSP00000117568
Gene: ENSMUSG00000028797

DomainStartEndE-ValueType
Pfam:UPF0546 11 62 1.1e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145345
SMART Domains Protein: ENSMUSP00000122893
Gene: ENSMUSG00000028797

DomainStartEndE-ValueType
Pfam:TMEM234 6 56 2.8e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150110
SMART Domains Protein: ENSMUSP00000122513
Gene: ENSMUSG00000028797

DomainStartEndE-ValueType
Pfam:UPF0546 11 58 1.6e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151969
SMART Domains Protein: ENSMUSP00000120878
Gene: ENSMUSG00000028797

DomainStartEndE-ValueType
Pfam:UPF0546 11 62 1.1e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152126
SMART Domains Protein: ENSMUSP00000120224
Gene: ENSMUSG00000028797

DomainStartEndE-ValueType
Pfam:UPF0546 11 62 1.1e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172774
SMART Domains Protein: ENSMUSP00000133502
Gene: ENSMUSG00000028797

DomainStartEndE-ValueType
Pfam:UPF0546 11 62 1.1e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173758
SMART Domains Protein: ENSMUSP00000134588
Gene: ENSMUSG00000028797

DomainStartEndE-ValueType
Pfam:UPF0546 11 117 3.2e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173937
SMART Domains Protein: ENSMUSP00000133412
Gene: ENSMUSG00000028797

DomainStartEndE-ValueType
Pfam:UPF0546 11 62 1.1e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174073
SMART Domains Protein: ENSMUSP00000133325
Gene: ENSMUSG00000028797

DomainStartEndE-ValueType
Pfam:UPF0546 11 62 1.1e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174819
SMART Domains Protein: ENSMUSP00000133695
Gene: ENSMUSG00000028797

DomainStartEndE-ValueType
Pfam:UPF0546 11 57 1.5e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000179209
AA Change: L243P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000135913
Gene: ENSMUSG00000078552
AA Change: L243P

DomainStartEndE-ValueType
DCX 1 86 1.32e-24 SMART
DCX 91 178 1.1e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000181579
SMART Domains Protein: ENSMUSP00000137989
Gene: ENSMUSG00000028797

DomainStartEndE-ValueType
Pfam:UPF0546 11 124 4.4e-42 PFAM
Meta Mutation Damage Score 0.1326 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: This gene encodes a member of the doublecortin family. The protein encoded by this gene contains two doublecortin domains. The doublecortin domain has been demonstrated to bind tubulin and enhance microtubule polymerization. [provided by RefSeq, Oct 2011]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T G 11: 84,260,679 V801G possibly damaging Het
Actbl2 T A 13: 111,255,593 M154K probably benign Het
Adam7 A T 14: 68,504,466 probably null Het
Arfgef1 T A 1: 10,180,897 T888S probably benign Het
AW554918 C T 18: 25,169,060 P10L possibly damaging Het
Bcap29 A G 12: 31,630,882 I35T probably damaging Het
Bhlhe40 TG TGG 6: 108,664,857 254 probably null Het
C87499 C A 4: 88,627,965 R380L probably benign Het
Cdc25b A G 2: 131,194,654 D458G probably damaging Het
Cdc42bpb T C 12: 111,305,667 K1104R probably benign Het
Cep89 A G 7: 35,438,378 N729S probably damaging Het
Clec4a4 T A 6: 122,991,829 M51K possibly damaging Het
Dennd5b G T 6: 149,036,483 H639N probably damaging Het
Dnah11 T G 12: 118,027,477 T2385P probably benign Het
Dnah11 T C 12: 118,125,785 E1182G probably damaging Het
Dok7 T C 5: 35,066,471 V81A probably damaging Het
Dtx1 T A 5: 120,682,393 M494L possibly damaging Het
Foxj1 A T 11: 116,332,254 L241Q possibly damaging Het
Gbp10 G A 5: 105,236,149 probably benign Het
Hnmt T A 2: 24,003,880 T201S probably benign Het
Jup G T 11: 100,378,351 T412K possibly damaging Het
Kcnh2 G A 5: 24,322,059 S954F probably damaging Het
Klhdc7b A C 15: 89,388,644 K585T possibly damaging Het
Klk7 T A 7: 43,812,000 S14T probably benign Het
Lama4 G A 10: 39,047,948 E451K probably damaging Het
Ldhb A G 6: 142,495,673 C164R probably damaging Het
Malrd1 G A 2: 15,610,090 D239N Het
Mgam T A 6: 40,666,854 V572E probably damaging Het
Mrgprb2 G T 7: 48,552,142 N278K probably damaging Het
Msto1 A G 3: 88,911,823 Y206H probably damaging Het
Myo6 A G 9: 80,262,291 S467G unknown Het
Mysm1 T A 4: 94,961,727 I447L probably benign Het
Nav3 T C 10: 109,852,934 E494G possibly damaging Het
Nol10 T G 12: 17,402,173 V376G probably damaging Het
Nup205 T A 6: 35,214,676 I1032N probably damaging Het
Olfr1002 T A 2: 85,647,424 D299V possibly damaging Het
Olfr1100 G A 2: 86,978,157 T213I probably benign Het
Olfr1170 A T 2: 88,225,022 Y3* probably null Het
Olfr1450 A G 19: 12,954,447 N286S probably damaging Het
Olfr449 T G 6: 42,838,746 Y288* probably null Het
Olfr455 A G 6: 42,538,728 F98S possibly damaging Het
Olfr617 A T 7: 103,584,381 I120L possibly damaging Het
Olfr782 A T 10: 129,350,557 probably benign Het
Olfr996 A G 2: 85,579,296 D19G probably benign Het
Oog2 A G 4: 144,195,281 K254E probably benign Het
Osbpl11 T A 16: 33,236,279 D694E probably benign Het
Pcm1 T A 8: 41,293,510 Y1210N probably benign Het
Pdxk T C 10: 78,440,863 M293V probably benign Het
Plcb3 T C 19: 6,962,867 I451V probably benign Het
Plekhm2 A G 4: 141,634,376 F272S probably damaging Het
Ptgdr A T 14: 44,858,232 probably null Het
Ptprf C T 4: 118,226,523 V788I probably benign Het
Ralbp1 C T 17: 65,854,148 V467I probably benign Het
Ralgds A C 2: 28,543,655 Q229P possibly damaging Het
Recql T C 6: 142,374,884 D146G probably damaging Het
Reln T C 5: 22,051,367 N493S probably damaging Het
Rfxank C T 8: 70,135,286 probably null Het
Scn5a A T 9: 119,486,530 M1704K probably damaging Het
Slc7a7 G T 14: 54,374,268 A316E possibly damaging Het
Slco1a6 A T 6: 142,091,068 C538S probably benign Het
Spert A G 14: 75,592,637 S39P probably benign Het
Stard6 T C 18: 70,498,647 probably null Het
Strip2 T A 6: 29,927,613 M219K possibly damaging Het
Tcam1 T C 11: 106,284,085 V122A probably damaging Het
Tha1 A G 11: 117,869,690 V236A possibly damaging Het
Tmem201 A T 4: 149,731,097 I132N possibly damaging Het
Tnc T C 4: 64,020,657 probably benign Het
Vmn1r42 T C 6: 89,845,513 T25A probably benign Het
Vmn2r94 T A 17: 18,244,503 probably null Het
Wdfy4 A C 14: 33,068,906 V2188G Het
Zfp623 T C 15: 75,947,398 S68P probably damaging Het
Zfp950 A T 19: 61,119,155 C497S probably damaging Het
Zkscan2 C T 7: 123,480,104 E877K probably damaging Het
Zp3r C A 1: 130,577,053 V536L probably damaging Het
Other mutations in Dcdc2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02104:Dcdc2b APN 4 129611074 missense probably benign 0.01
IGL03210:Dcdc2b APN 4 129611785 missense probably benign 0.02
R0094:Dcdc2b UTSW 4 129610311 splice site probably null
R0362:Dcdc2b UTSW 4 129610238 splice site probably null
R4565:Dcdc2b UTSW 4 129610985 missense probably benign 0.00
R4677:Dcdc2b UTSW 4 129614143 missense probably damaging 1.00
R4911:Dcdc2b UTSW 4 129611267 missense possibly damaging 0.95
R5364:Dcdc2b UTSW 4 129609170 missense probably damaging 1.00
RF031:Dcdc2b UTSW 4 129609651 unclassified probably benign
RF033:Dcdc2b UTSW 4 129609651 unclassified probably benign
RF036:Dcdc2b UTSW 4 129609651 unclassified probably benign
RF039:Dcdc2b UTSW 4 129609651 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TGGCACATAGCTCTGCTGAC -3'
(R):5'- GCCAGCGTCAATTCAACTATTTCTG -3'

Sequencing Primer
(F):5'- GACTCATTCTGCTGCAGACATC -3'
(R):5'- CAACTATTTCTGGATAGACAGCCTGG -3'
Posted On 2019-09-13