Incidental Mutation 'R7399:Plekhm2'
ID574014
Institutional Source Beutler Lab
Gene Symbol Plekhm2
Ensembl Gene ENSMUSG00000028917
Gene Namepleckstrin homology domain containing, family M (with RUN domain) member 2
Synonyms2310034J19Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7399 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location141625734-141664899 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 141634376 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 272 (F272S)
Ref Sequence ENSEMBL: ENSMUSP00000081221 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030751] [ENSMUST00000084203]
Predicted Effect probably damaging
Transcript: ENSMUST00000030751
AA Change: F252S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000030751
Gene: ENSMUSG00000028917
AA Change: F252S

DomainStartEndE-ValueType
RUN 93 156 3.18e-21 SMART
low complexity region 230 246 N/A INTRINSIC
low complexity region 295 307 N/A INTRINSIC
low complexity region 459 469 N/A INTRINSIC
low complexity region 485 495 N/A INTRINSIC
low complexity region 505 538 N/A INTRINSIC
Blast:PH 596 656 7e-31 BLAST
PH 766 869 2.43e-12 SMART
Blast:PH 879 960 6e-9 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000084203
AA Change: F272S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000081221
Gene: ENSMUSG00000028917
AA Change: F272S

DomainStartEndE-ValueType
RUN 93 156 3.18e-21 SMART
low complexity region 250 266 N/A INTRINSIC
low complexity region 315 327 N/A INTRINSIC
low complexity region 479 489 N/A INTRINSIC
low complexity region 505 515 N/A INTRINSIC
low complexity region 525 558 N/A INTRINSIC
Blast:PH 616 676 7e-31 BLAST
PH 786 889 2.43e-12 SMART
Blast:PH 899 980 6e-9 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136102
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140223
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150229
Meta Mutation Damage Score 0.3022 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that binds the plus-end directed microtubule motor protein kinesin, together with the lysosomal GTPase Arl8, and is required for lysosomes to distribute away from the microtubule-organizing center. The encoded protein belongs to the multisubunit BLOC-one-related complex that regulates lysosome positioning. It binds a Salmonella effector protein called Salmonella induced filament A and is a critical host determinant in Salmonella pathogenesis. It has a domain architecture consisting of an N-terminal RPIP8, UNC-14, and NESCA (RUN) domain that binds kinesin-1 as well as the lysosomal GTPase Arl8, and a C-terminal pleckstrin homology domain that binds the Salmonella induced filament A effector protein. Naturally occurring mutations in this gene lead to abnormal localization of lysosomes, impaired autophagy flux and are associated with recessive dilated cardiomyopathy and left ventricular noncompaction. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased leukocyte numbers and decreased susceptibility to Salmonella infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T G 11: 84,260,679 V801G possibly damaging Het
Actbl2 T A 13: 111,255,593 M154K probably benign Het
Adam7 A T 14: 68,504,466 probably null Het
Arfgef1 T A 1: 10,180,897 T888S probably benign Het
AW554918 C T 18: 25,169,060 P10L possibly damaging Het
Bcap29 A G 12: 31,630,882 I35T probably damaging Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
C87499 C A 4: 88,627,965 R380L probably benign Het
Cdc25b A G 2: 131,194,654 D458G probably damaging Het
Cdc42bpb T C 12: 111,305,667 K1104R probably benign Het
Cep89 A G 7: 35,438,378 N729S probably damaging Het
Clec4a4 T A 6: 122,991,829 M51K possibly damaging Het
Dcdc2b A G 4: 129,609,629 L270P probably damaging Het
Dennd5b G T 6: 149,036,483 H639N probably damaging Het
Dnah11 T G 12: 118,027,477 T2385P probably benign Het
Dnah11 T C 12: 118,125,785 E1182G probably damaging Het
Dok7 T C 5: 35,066,471 V81A probably damaging Het
Dtx1 T A 5: 120,682,393 M494L possibly damaging Het
Foxj1 A T 11: 116,332,254 L241Q possibly damaging Het
Gbp10 G A 5: 105,236,149 probably benign Het
Hnmt T A 2: 24,003,880 T201S probably benign Het
Jup G T 11: 100,378,351 T412K possibly damaging Het
Kcnh2 G A 5: 24,322,059 S954F probably damaging Het
Klhdc7b A C 15: 89,388,644 K585T possibly damaging Het
Klk7 T A 7: 43,812,000 S14T probably benign Het
Lama4 G A 10: 39,047,948 E451K probably damaging Het
Ldhb A G 6: 142,495,673 C164R probably damaging Het
Malrd1 G A 2: 15,610,090 D239N Het
Mgam T A 6: 40,666,854 V572E probably damaging Het
Mrgprb2 G T 7: 48,552,142 N278K probably damaging Het
Msto1 A G 3: 88,911,823 Y206H probably damaging Het
Myo6 A G 9: 80,262,291 S467G unknown Het
Mysm1 T A 4: 94,961,727 I447L probably benign Het
Nav3 T C 10: 109,852,934 E494G possibly damaging Het
Nol10 T G 12: 17,402,173 V376G probably damaging Het
Nup205 T A 6: 35,214,676 I1032N probably damaging Het
Olfr1002 T A 2: 85,647,424 D299V possibly damaging Het
Olfr1100 G A 2: 86,978,157 T213I probably benign Het
Olfr1170 A T 2: 88,225,022 Y3* probably null Het
Olfr1450 A G 19: 12,954,447 N286S probably damaging Het
Olfr449 T G 6: 42,838,746 Y288* probably null Het
Olfr455 A G 6: 42,538,728 F98S possibly damaging Het
Olfr617 A T 7: 103,584,381 I120L possibly damaging Het
Olfr782 A T 10: 129,350,557 probably benign Het
Olfr996 A G 2: 85,579,296 D19G probably benign Het
Oog2 A G 4: 144,195,281 K254E probably benign Het
Osbpl11 T A 16: 33,236,279 D694E probably benign Het
Pcm1 T A 8: 41,293,510 Y1210N probably benign Het
Pdxk T C 10: 78,440,863 M293V probably benign Het
Plcb3 T C 19: 6,962,867 I451V probably benign Het
Ptgdr A T 14: 44,858,232 probably null Het
Ptprf C T 4: 118,226,523 V788I probably benign Het
Ralbp1 C T 17: 65,854,148 V467I probably benign Het
Ralgds A C 2: 28,543,655 Q229P possibly damaging Het
Recql T C 6: 142,374,884 D146G probably damaging Het
Reln T C 5: 22,051,367 N493S probably damaging Het
Rfxank C T 8: 70,135,286 probably null Het
Scn5a A T 9: 119,486,530 M1704K probably damaging Het
Slc7a7 G T 14: 54,374,268 A316E possibly damaging Het
Slco1a6 A T 6: 142,091,068 C538S probably benign Het
Spert A G 14: 75,592,637 S39P probably benign Het
Stard6 T C 18: 70,498,647 probably null Het
Strip2 T A 6: 29,927,613 M219K possibly damaging Het
Tcam1 T C 11: 106,284,085 V122A probably damaging Het
Tha1 A G 11: 117,869,690 V236A possibly damaging Het
Tmem201 A T 4: 149,731,097 I132N possibly damaging Het
Tnc T C 4: 64,020,657 probably benign Het
Vmn1r42 T C 6: 89,845,513 T25A probably benign Het
Vmn2r94 T A 17: 18,244,503 probably null Het
Wdfy4 A C 14: 33,068,906 V2188G Het
Zfp623 T C 15: 75,947,398 S68P probably damaging Het
Zfp950 A T 19: 61,119,155 C497S probably damaging Het
Zkscan2 C T 7: 123,480,104 E877K probably damaging Het
Zp3r C A 1: 130,577,053 V536L probably damaging Het
Other mutations in Plekhm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01060:Plekhm2 APN 4 141642645 splice site probably null
IGL01388:Plekhm2 APN 4 141642001 missense probably damaging 1.00
IGL01392:Plekhm2 APN 4 141642426 missense probably damaging 0.98
IGL01482:Plekhm2 APN 4 141630029 missense probably damaging 0.98
IGL01828:Plekhm2 APN 4 141629585 missense probably benign 0.11
IGL02010:Plekhm2 APN 4 141637419 splice site probably benign
IGL02075:Plekhm2 APN 4 141628306 missense probably benign 0.38
IGL02381:Plekhm2 APN 4 141642723 missense possibly damaging 0.95
IGL02543:Plekhm2 APN 4 141642019 missense probably benign 0.02
IGL02747:Plekhm2 APN 4 141634272 missense possibly damaging 0.55
IGL02802:Plekhm2 APN 4 141642524 splice site probably benign
IGL02828:Plekhm2 APN 4 141629630 missense probably damaging 1.00
IGL03286:Plekhm2 APN 4 141634347 missense possibly damaging 0.95
R0008:Plekhm2 UTSW 4 141642393 splice site probably benign
R0008:Plekhm2 UTSW 4 141642393 splice site probably benign
R0639:Plekhm2 UTSW 4 141642070 missense probably damaging 1.00
R0682:Plekhm2 UTSW 4 141628125 missense probably damaging 0.97
R0968:Plekhm2 UTSW 4 141629932 missense probably benign 0.01
R1109:Plekhm2 UTSW 4 141627984 missense probably benign 0.31
R1475:Plekhm2 UTSW 4 141627854 missense possibly damaging 0.75
R1802:Plekhm2 UTSW 4 141634347 missense probably benign 0.03
R1813:Plekhm2 UTSW 4 141642439 missense possibly damaging 0.93
R1844:Plekhm2 UTSW 4 141632374 missense probably benign
R2261:Plekhm2 UTSW 4 141642732 missense probably damaging 0.98
R3889:Plekhm2 UTSW 4 141641990 splice site probably benign
R3922:Plekhm2 UTSW 4 141629532 missense probably benign 0.01
R4324:Plekhm2 UTSW 4 141631857 missense possibly damaging 0.86
R4758:Plekhm2 UTSW 4 141642005 missense possibly damaging 0.91
R4814:Plekhm2 UTSW 4 141627839 missense probably benign 0.00
R4983:Plekhm2 UTSW 4 141634376 missense probably damaging 1.00
R5468:Plekhm2 UTSW 4 141628100 missense probably damaging 1.00
R5691:Plekhm2 UTSW 4 141628289 missense possibly damaging 0.96
R5877:Plekhm2 UTSW 4 141639693 missense probably damaging 0.98
R6268:Plekhm2 UTSW 4 141632341 nonsense probably null
R6367:Plekhm2 UTSW 4 141639705 missense probably damaging 0.97
R6371:Plekhm2 UTSW 4 141629532 missense possibly damaging 0.94
R6489:Plekhm2 UTSW 4 141632033 missense probably damaging 1.00
R7266:Plekhm2 UTSW 4 141642459 missense possibly damaging 0.91
R7573:Plekhm2 UTSW 4 141631347 missense probably benign 0.02
R7742:Plekhm2 UTSW 4 141627839 missense probably benign 0.00
R7864:Plekhm2 UTSW 4 141628046 missense probably damaging 0.96
R7920:Plekhm2 UTSW 4 141632121 missense probably damaging 1.00
R8417:Plekhm2 UTSW 4 141627825 missense probably benign 0.04
R8504:Plekhm2 UTSW 4 141642453 missense probably damaging 1.00
T0722:Plekhm2 UTSW 4 141631981 small deletion probably benign
T0975:Plekhm2 UTSW 4 141631981 small deletion probably benign
X0024:Plekhm2 UTSW 4 141628041 missense probably damaging 1.00
Z1177:Plekhm2 UTSW 4 141629085 missense possibly damaging 0.77
Z1177:Plekhm2 UTSW 4 141639822 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- TAGTAAGTCCACAGAGGCTCG -3'
(R):5'- TTCAACTAGGGCCACTGTGG -3'

Sequencing Primer
(F):5'- ACAGAGGCTCGTCCACCTTC -3'
(R):5'- CTCCCCTGAGATAAGGCATTC -3'
Posted On2019-09-13