Incidental Mutation 'R7399:Strip2'
ID574022
Institutional Source Beutler Lab
Gene Symbol Strip2
Ensembl Gene ENSMUSG00000039629
Gene Namestriatin interacting protein 2
SynonymsFam40b, D330017J20Rik
MMRRC Submission
Accession Numbers

Genbank: NM_177204.3, NM_001037740.1; Ensembl: ENSMUST00000046028

Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R7399 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location29917012-29959681 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 29927613 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 219 (M219K)
Ref Sequence ENSEMBL: ENSMUSP00000036477 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046028] [ENSMUST00000115224] [ENSMUST00000151738]
Predicted Effect possibly damaging
Transcript: ENSMUST00000046028
AA Change: M219K

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000036477
Gene: ENSMUSG00000039629
AA Change: M219K

DomainStartEndE-ValueType
low complexity region 2 40 N/A INTRINSIC
N1221 57 364 1.68e-132 SMART
low complexity region 376 394 N/A INTRINSIC
low complexity region 398 419 N/A INTRINSIC
DUF3402 466 822 4.98e-199 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115224
AA Change: M219K

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000110879
Gene: ENSMUSG00000039629
AA Change: M219K

DomainStartEndE-ValueType
low complexity region 2 40 N/A INTRINSIC
N1221 57 364 1.68e-132 SMART
low complexity region 376 394 N/A INTRINSIC
low complexity region 398 419 N/A INTRINSIC
DUF3402 466 662 4.85e-24 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000151738
AA Change: M219K

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000119506
Gene: ENSMUSG00000039629
AA Change: M219K

DomainStartEndE-ValueType
low complexity region 2 40 N/A INTRINSIC
N1221 57 364 1.68e-132 SMART
low complexity region 376 394 N/A INTRINSIC
low complexity region 398 419 N/A INTRINSIC
DUF3402 466 794 1.72e-161 SMART
Meta Mutation Damage Score 0.7299 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (74/75)
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T G 11: 84,260,679 V801G possibly damaging Het
Actbl2 T A 13: 111,255,593 M154K probably benign Het
Adam7 A T 14: 68,504,466 probably null Het
Arfgef1 T A 1: 10,180,897 T888S probably benign Het
AW554918 C T 18: 25,169,060 P10L possibly damaging Het
Bcap29 A G 12: 31,630,882 I35T probably damaging Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
C87499 C A 4: 88,627,965 R380L probably benign Het
Cdc25b A G 2: 131,194,654 D458G probably damaging Het
Cdc42bpb T C 12: 111,305,667 K1104R probably benign Het
Cep89 A G 7: 35,438,378 N729S probably damaging Het
Clec4a4 T A 6: 122,991,829 M51K possibly damaging Het
Dcdc2b A G 4: 129,609,629 L270P probably damaging Het
Dennd5b G T 6: 149,036,483 H639N probably damaging Het
Dnah11 T G 12: 118,027,477 T2385P probably benign Het
Dnah11 T C 12: 118,125,785 E1182G probably damaging Het
Dok7 T C 5: 35,066,471 V81A probably damaging Het
Dtx1 T A 5: 120,682,393 M494L possibly damaging Het
Foxj1 A T 11: 116,332,254 L241Q possibly damaging Het
Gbp10 G A 5: 105,236,149 probably benign Het
Hnmt T A 2: 24,003,880 T201S probably benign Het
Jup G T 11: 100,378,351 T412K possibly damaging Het
Kcnh2 G A 5: 24,322,059 S954F probably damaging Het
Klhdc7b A C 15: 89,388,644 K585T possibly damaging Het
Klk7 T A 7: 43,812,000 S14T probably benign Het
Lama4 G A 10: 39,047,948 E451K probably damaging Het
Ldhb A G 6: 142,495,673 C164R probably damaging Het
Malrd1 G A 2: 15,610,090 D239N Het
Mgam T A 6: 40,666,854 V572E probably damaging Het
Mrgprb2 G T 7: 48,552,142 N278K probably damaging Het
Msto1 A G 3: 88,911,823 Y206H probably damaging Het
Myo6 A G 9: 80,262,291 S467G unknown Het
Mysm1 T A 4: 94,961,727 I447L probably benign Het
Nav3 T C 10: 109,852,934 E494G possibly damaging Het
Nol10 T G 12: 17,402,173 V376G probably damaging Het
Nup205 T A 6: 35,214,676 I1032N probably damaging Het
Olfr1002 T A 2: 85,647,424 D299V possibly damaging Het
Olfr1100 G A 2: 86,978,157 T213I probably benign Het
Olfr1170 A T 2: 88,225,022 Y3* probably null Het
Olfr1450 A G 19: 12,954,447 N286S probably damaging Het
Olfr449 T G 6: 42,838,746 Y288* probably null Het
Olfr455 A G 6: 42,538,728 F98S possibly damaging Het
Olfr617 A T 7: 103,584,381 I120L possibly damaging Het
Olfr782 A T 10: 129,350,557 probably benign Het
Olfr996 A G 2: 85,579,296 D19G probably benign Het
Oog2 A G 4: 144,195,281 K254E probably benign Het
Osbpl11 T A 16: 33,236,279 D694E probably benign Het
Pcm1 T A 8: 41,293,510 Y1210N probably benign Het
Pdxk T C 10: 78,440,863 M293V probably benign Het
Plcb3 T C 19: 6,962,867 I451V probably benign Het
Plekhm2 A G 4: 141,634,376 F272S probably damaging Het
Ptgdr A T 14: 44,858,232 probably null Het
Ptprf C T 4: 118,226,523 V788I probably benign Het
Ralbp1 C T 17: 65,854,148 V467I probably benign Het
Ralgds A C 2: 28,543,655 Q229P possibly damaging Het
Recql T C 6: 142,374,884 D146G probably damaging Het
Reln T C 5: 22,051,367 N493S probably damaging Het
Rfxank C T 8: 70,135,286 probably null Het
Scn5a A T 9: 119,486,530 M1704K probably damaging Het
Slc7a7 G T 14: 54,374,268 A316E possibly damaging Het
Slco1a6 A T 6: 142,091,068 C538S probably benign Het
Spert A G 14: 75,592,637 S39P probably benign Het
Stard6 T C 18: 70,498,647 probably null Het
Tcam1 T C 11: 106,284,085 V122A probably damaging Het
Tha1 A G 11: 117,869,690 V236A possibly damaging Het
Tmem201 A T 4: 149,731,097 I132N possibly damaging Het
Tnc T C 4: 64,020,657 probably benign Het
Vmn1r42 T C 6: 89,845,513 T25A probably benign Het
Vmn2r94 T A 17: 18,244,503 probably null Het
Wdfy4 A C 14: 33,068,906 V2188G Het
Zfp623 T C 15: 75,947,398 S68P probably damaging Het
Zfp950 A T 19: 61,119,155 C497S probably damaging Het
Zkscan2 C T 7: 123,480,104 E877K probably damaging Het
Zp3r C A 1: 130,577,053 V536L probably damaging Het
Other mutations in Strip2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00472:Strip2 APN 6 29931214 missense probably benign 0.04
IGL01357:Strip2 APN 6 29939167 splice site probably benign
IGL01636:Strip2 APN 6 29931193 missense probably benign 0.06
IGL01959:Strip2 APN 6 29928554 missense probably damaging 0.99
IGL01961:Strip2 APN 6 29928427 splice site probably benign
IGL02089:Strip2 APN 6 29917180 unclassified probably benign
1mM(1):Strip2 UTSW 6 29955631 missense probably damaging 1.00
R0079:Strip2 UTSW 6 29920533 critical splice donor site probably null
R0331:Strip2 UTSW 6 29926560 missense probably benign 0.44
R0367:Strip2 UTSW 6 29937651 missense possibly damaging 0.90
R0592:Strip2 UTSW 6 29931210 missense probably benign 0.28
R1087:Strip2 UTSW 6 29927634 missense probably damaging 0.99
R1390:Strip2 UTSW 6 29929829 missense probably damaging 1.00
R1758:Strip2 UTSW 6 29941941 critical splice donor site probably null
R2213:Strip2 UTSW 6 29931148 missense probably damaging 0.99
R2437:Strip2 UTSW 6 29941941 critical splice donor site probably null
R2900:Strip2 UTSW 6 29939035 critical splice acceptor site probably null
R3892:Strip2 UTSW 6 29917075 unclassified probably benign
R4010:Strip2 UTSW 6 29955585 missense possibly damaging 0.66
R4435:Strip2 UTSW 6 29925050 missense probably benign 0.06
R4807:Strip2 UTSW 6 29925093 nonsense probably null
R5015:Strip2 UTSW 6 29931266 missense probably benign 0.03
R5080:Strip2 UTSW 6 29945593 missense probably damaging 0.99
R5484:Strip2 UTSW 6 29917155 unclassified probably benign
R5502:Strip2 UTSW 6 29927624 missense probably benign 0.23
R5899:Strip2 UTSW 6 29956958 utr 3 prime probably benign
R6004:Strip2 UTSW 6 29926571 missense probably damaging 0.98
R6479:Strip2 UTSW 6 29944497 splice site probably null
R6835:Strip2 UTSW 6 29941917 missense probably damaging 1.00
R7068:Strip2 UTSW 6 29932208 missense probably benign 0.03
R7073:Strip2 UTSW 6 29941912 missense possibly damaging 0.95
R7088:Strip2 UTSW 6 29920533 critical splice donor site probably null
R7231:Strip2 UTSW 6 29944487 missense probably damaging 0.96
R7813:Strip2 UTSW 6 29923913 critical splice acceptor site probably null
R7827:Strip2 UTSW 6 29923929 missense probably benign 0.18
R8354:Strip2 UTSW 6 29920532 critical splice donor site probably null
R8723:Strip2 UTSW 6 29941864 missense probably damaging 1.00
R8750:Strip2 UTSW 6 29931816 missense probably damaging 0.96
R8793:Strip2 UTSW 6 29956816 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- AGCTCAGGTGAGTGAAGTGACC -3'
(R):5'- AAAAGGAGAGCTTTCCTCCCTG -3'

Sequencing Primer
(F):5'- ATGAGTGGCATGTGTTACCC -3'
(R):5'- GAGCTTTCCTCCCTGGCAGAC -3'
Posted On2019-09-13