Incidental Mutation 'R7399:Myo6'
ID574040
Institutional Source Beutler Lab
Gene Symbol Myo6
Ensembl Gene ENSMUSG00000033577
Gene Namemyosin VI
SynonymsTlc
MMRRC Submission
Accession Numbers

MGI:104785

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7399 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location80165031-80311729 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 80262291 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 467 (S467G)
Ref Sequence ENSEMBL: ENSMUSP00000139019 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035889] [ENSMUST00000076140] [ENSMUST00000113266] [ENSMUST00000113268] [ENSMUST00000127779] [ENSMUST00000184480]
Predicted Effect probably damaging
Transcript: ENSMUST00000035889
AA Change: S467G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000036181
Gene: ENSMUSG00000033577
AA Change: S467G

DomainStartEndE-ValueType
MYSc 51 772 N/A SMART
IQ 812 834 8.58e-1 SMART
low complexity region 909 980 N/A INTRINSIC
low complexity region 982 1002 N/A INTRINSIC
Blast:MYSc 1003 1113 3e-29 BLAST
PDB:3H8D|D 1134 1262 1e-74 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000076140
AA Change: S467G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000075501
Gene: ENSMUSG00000033577
AA Change: S467G

DomainStartEndE-ValueType
MYSc 51 772 N/A SMART
IQ 812 834 8.58e-1 SMART
low complexity region 909 980 N/A INTRINSIC
low complexity region 982 1002 N/A INTRINSIC
Blast:MYSc 1003 1126 2e-27 BLAST
PDB:3H8D|D 1138 1266 8e-75 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000113266
AA Change: S467G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108891
Gene: ENSMUSG00000033577
AA Change: S467G

DomainStartEndE-ValueType
MYSc 51 772 N/A SMART
IQ 812 834 8.58e-1 SMART
low complexity region 909 980 N/A INTRINSIC
low complexity region 982 1002 N/A INTRINSIC
Blast:MYSc 1003 1113 3e-29 BLAST
PDB:3H8D|D 1125 1253 9e-75 PDB
Predicted Effect unknown
Transcript: ENSMUST00000113268
AA Change: S467G
SMART Domains Protein: ENSMUSP00000108893
Gene: ENSMUSG00000033577
AA Change: S467G

DomainStartEndE-ValueType
MYSc 51 772 N/A SMART
IQ 812 834 8.58e-1 SMART
low complexity region 909 980 N/A INTRINSIC
low complexity region 982 1002 N/A INTRINSIC
Blast:MYSc 1003 1135 2e-26 BLAST
Pfam:Myosin-VI_CBD 1167 1257 1.4e-46 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000127779
AA Change: S467G
SMART Domains Protein: ENSMUSP00000139228
Gene: ENSMUSG00000033577
AA Change: S467G

DomainStartEndE-ValueType
MYSc 51 772 N/A SMART
IQ 812 834 8.58e-1 SMART
low complexity region 909 980 N/A INTRINSIC
low complexity region 982 1002 N/A INTRINSIC
Blast:MYSc 1003 1136 1e-26 BLAST
PDB:3H8D|D 1157 1285 9e-75 PDB
Predicted Effect unknown
Transcript: ENSMUST00000184480
AA Change: S467G
SMART Domains Protein: ENSMUSP00000139019
Gene: ENSMUSG00000033577
AA Change: S467G

DomainStartEndE-ValueType
MYSc 51 772 N/A SMART
IQ 812 834 8.58e-1 SMART
low complexity region 909 980 N/A INTRINSIC
low complexity region 982 1002 N/A INTRINSIC
Blast:MYSc 1003 1145 1e-25 BLAST
PDB:3H8D|D 1166 1294 8e-75 PDB
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a reverse-direction motor protein that moves toward the minus end of actin filaments and plays a role in intracellular vesicle and organelle transport. The protein consists of a motor domain containing an ATP- and an actin-binding site and a globular tail which interacts with other proteins. This protein maintains the structural integrity of inner ear hair cells and mutations in this gene cause non-syndromic autosomal dominant and recessive hearing loss. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2014]
PHENOTYPE: Homozygous mutant mice exhibit deafness and related behavioral characteristics such as circling, head tossing and hyperactivity. Progressive degeneration of the cochlear hair cells and the organ of Corti is observed with one mutation. [provided by MGI curators]
Allele List at MGI

All alleles(13) : Targeted, other(2) Gene trapped(6) Spontaneous(3) Chemically induced(2)

Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T G 11: 84,260,679 V801G possibly damaging Het
Actbl2 T A 13: 111,255,593 M154K probably benign Het
Adam7 A T 14: 68,504,466 probably null Het
Arfgef1 T A 1: 10,180,897 T888S probably benign Het
AW554918 C T 18: 25,169,060 P10L possibly damaging Het
Bcap29 A G 12: 31,630,882 I35T probably damaging Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
C87499 C A 4: 88,627,965 R380L probably benign Het
Cdc25b A G 2: 131,194,654 D458G probably damaging Het
Cdc42bpb T C 12: 111,305,667 K1104R probably benign Het
Cep89 A G 7: 35,438,378 N729S probably damaging Het
Clec4a4 T A 6: 122,991,829 M51K possibly damaging Het
Dcdc2b A G 4: 129,609,629 L270P probably damaging Het
Dennd5b G T 6: 149,036,483 H639N probably damaging Het
Dnah11 T G 12: 118,027,477 T2385P probably benign Het
Dnah11 T C 12: 118,125,785 E1182G probably damaging Het
Dok7 T C 5: 35,066,471 V81A probably damaging Het
Dtx1 T A 5: 120,682,393 M494L possibly damaging Het
Foxj1 A T 11: 116,332,254 L241Q possibly damaging Het
Gbp10 G A 5: 105,236,149 probably benign Het
Hnmt T A 2: 24,003,880 T201S probably benign Het
Jup G T 11: 100,378,351 T412K possibly damaging Het
Kcnh2 G A 5: 24,322,059 S954F probably damaging Het
Klhdc7b A C 15: 89,388,644 K585T possibly damaging Het
Klk7 T A 7: 43,812,000 S14T probably benign Het
Lama4 G A 10: 39,047,948 E451K probably damaging Het
Ldhb A G 6: 142,495,673 C164R probably damaging Het
Malrd1 G A 2: 15,610,090 D239N Het
Mgam T A 6: 40,666,854 V572E probably damaging Het
Mrgprb2 G T 7: 48,552,142 N278K probably damaging Het
Msto1 A G 3: 88,911,823 Y206H probably damaging Het
Mysm1 T A 4: 94,961,727 I447L probably benign Het
Nav3 T C 10: 109,852,934 E494G possibly damaging Het
Nol10 T G 12: 17,402,173 V376G probably damaging Het
Nup205 T A 6: 35,214,676 I1032N probably damaging Het
Olfr1002 T A 2: 85,647,424 D299V possibly damaging Het
Olfr1100 G A 2: 86,978,157 T213I probably benign Het
Olfr1170 A T 2: 88,225,022 Y3* probably null Het
Olfr1450 A G 19: 12,954,447 N286S probably damaging Het
Olfr449 T G 6: 42,838,746 Y288* probably null Het
Olfr455 A G 6: 42,538,728 F98S possibly damaging Het
Olfr617 A T 7: 103,584,381 I120L possibly damaging Het
Olfr782 A T 10: 129,350,557 probably benign Het
Olfr996 A G 2: 85,579,296 D19G probably benign Het
Oog2 A G 4: 144,195,281 K254E probably benign Het
Osbpl11 T A 16: 33,236,279 D694E probably benign Het
Pcm1 T A 8: 41,293,510 Y1210N probably benign Het
Pdxk T C 10: 78,440,863 M293V probably benign Het
Plcb3 T C 19: 6,962,867 I451V probably benign Het
Plekhm2 A G 4: 141,634,376 F272S probably damaging Het
Ptgdr A T 14: 44,858,232 probably null Het
Ptprf C T 4: 118,226,523 V788I probably benign Het
Ralbp1 C T 17: 65,854,148 V467I probably benign Het
Ralgds A C 2: 28,543,655 Q229P possibly damaging Het
Recql T C 6: 142,374,884 D146G probably damaging Het
Reln T C 5: 22,051,367 N493S probably damaging Het
Rfxank C T 8: 70,135,286 probably null Het
Scn5a A T 9: 119,486,530 M1704K probably damaging Het
Slc7a7 G T 14: 54,374,268 A316E possibly damaging Het
Slco1a6 A T 6: 142,091,068 C538S probably benign Het
Spert A G 14: 75,592,637 S39P probably benign Het
Stard6 T C 18: 70,498,647 probably null Het
Strip2 T A 6: 29,927,613 M219K possibly damaging Het
Tcam1 T C 11: 106,284,085 V122A probably damaging Het
Tha1 A G 11: 117,869,690 V236A possibly damaging Het
Tmem201 A T 4: 149,731,097 I132N possibly damaging Het
Tnc T C 4: 64,020,657 probably benign Het
Vmn1r42 T C 6: 89,845,513 T25A probably benign Het
Vmn2r94 T A 17: 18,244,503 probably null Het
Wdfy4 A C 14: 33,068,906 V2188G Het
Zfp623 T C 15: 75,947,398 S68P probably damaging Het
Zfp950 A T 19: 61,119,155 C497S probably damaging Het
Zkscan2 C T 7: 123,480,104 E877K probably damaging Het
Zp3r C A 1: 130,577,053 V536L probably damaging Het
Other mutations in Myo6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Myo6 APN 9 80292472 missense probably damaging 0.98
IGL00584:Myo6 APN 9 80242273 splice site probably benign
IGL00596:Myo6 APN 9 80281743 missense possibly damaging 0.91
IGL00778:Myo6 APN 9 80283586 critical splice donor site probably null
IGL01667:Myo6 APN 9 80289893 missense unknown
IGL01939:Myo6 APN 9 80260818 missense probably damaging 1.00
IGL02123:Myo6 APN 9 80264272 splice site probably benign
IGL02271:Myo6 APN 9 80260831 missense probably benign 0.01
IGL02512:Myo6 APN 9 80292519 critical splice donor site probably null
IGL02716:Myo6 APN 9 80269694 missense probably damaging 1.00
IGL02888:Myo6 APN 9 80269731 splice site probably benign
IGL02890:Myo6 APN 9 80266174 missense probably damaging 1.00
IGL02951:Myo6 APN 9 80264234 missense possibly damaging 0.66
IGL02990:Myo6 APN 9 80276403 critical splice donor site probably null
IGL03060:Myo6 APN 9 80260877 missense probably benign 0.00
IGL03145:Myo6 APN 9 80300665 nonsense probably null
IGL03306:Myo6 APN 9 80246555 missense probably damaging 1.00
mayday_circler UTSW 9 80246451 nonsense probably null
torticollis UTSW 9 80288217 critical splice donor site probably null
truths UTSW 9 80270039 nonsense probably null
IGL03134:Myo6 UTSW 9 80292467 missense probably damaging 0.96
R0023:Myo6 UTSW 9 80283534 missense possibly damaging 0.62
R0023:Myo6 UTSW 9 80283534 missense possibly damaging 0.62
R0124:Myo6 UTSW 9 80307774 missense probably damaging 1.00
R0133:Myo6 UTSW 9 80273975 splice site probably benign
R0207:Myo6 UTSW 9 80288056 missense probably damaging 1.00
R0295:Myo6 UTSW 9 80283579 missense probably damaging 0.98
R0389:Myo6 UTSW 9 80292466 missense probably damaging 0.98
R0432:Myo6 UTSW 9 80273974 splice site probably benign
R0526:Myo6 UTSW 9 80283541 missense possibly damaging 0.61
R0791:Myo6 UTSW 9 80262374 splice site probably benign
R0885:Myo6 UTSW 9 80242221 missense probably damaging 1.00
R1082:Myo6 UTSW 9 80288021 missense probably damaging 1.00
R1113:Myo6 UTSW 9 80245714 missense probably damaging 1.00
R1184:Myo6 UTSW 9 80286382 nonsense probably null
R1308:Myo6 UTSW 9 80245714 missense probably damaging 1.00
R1498:Myo6 UTSW 9 80307679 missense probably damaging 1.00
R1609:Myo6 UTSW 9 80288217 critical splice donor site probably null
R1615:Myo6 UTSW 9 80307725 missense probably damaging 1.00
R1771:Myo6 UTSW 9 80285800 missense probably damaging 1.00
R1772:Myo6 UTSW 9 80270049 missense possibly damaging 0.95
R1789:Myo6 UTSW 9 80300572 missense probably damaging 1.00
R1962:Myo6 UTSW 9 80260835 missense probably damaging 1.00
R1978:Myo6 UTSW 9 80228925 missense probably damaging 0.99
R2011:Myo6 UTSW 9 80307722 missense probably damaging 0.99
R2092:Myo6 UTSW 9 80245682 missense probably damaging 1.00
R2098:Myo6 UTSW 9 80281526 missense probably damaging 1.00
R2206:Myo6 UTSW 9 80258455 missense probably benign 0.01
R2286:Myo6 UTSW 9 80266212 missense possibly damaging 0.82
R2429:Myo6 UTSW 9 80303301 critical splice donor site probably null
R2696:Myo6 UTSW 9 80260894 missense probably benign 0.00
R2897:Myo6 UTSW 9 80269611 splice site probably null
R2898:Myo6 UTSW 9 80269611 splice site probably null
R3881:Myo6 UTSW 9 80264256 missense probably damaging 1.00
R4424:Myo6 UTSW 9 80288038 missense probably benign 0.26
R4718:Myo6 UTSW 9 80246517 missense probably benign 0.01
R4893:Myo6 UTSW 9 80228877 missense probably damaging 1.00
R4936:Myo6 UTSW 9 80307681 missense probably damaging 1.00
R4992:Myo6 UTSW 9 80283510 missense possibly damaging 0.95
R5073:Myo6 UTSW 9 80288008 missense probably benign 0.00
R5101:Myo6 UTSW 9 80270039 nonsense probably null
R5137:Myo6 UTSW 9 80242249 missense probably damaging 1.00
R5200:Myo6 UTSW 9 80276374 nonsense probably null
R5510:Myo6 UTSW 9 80245660 missense probably damaging 1.00
R5579:Myo6 UTSW 9 80217720 missense probably damaging 0.99
R5693:Myo6 UTSW 9 80266180 missense probably damaging 1.00
R5701:Myo6 UTSW 9 80258527 missense probably damaging 1.00
R6693:Myo6 UTSW 9 80245731 missense probably damaging 1.00
R7151:Myo6 UTSW 9 80245136 missense unknown
R7492:Myo6 UTSW 9 80288046 nonsense probably null
R7651:Myo6 UTSW 9 80264266 critical splice donor site probably null
R7698:Myo6 UTSW 9 80217656 missense unknown
R7743:Myo6 UTSW 9 80276329 missense unknown
R7888:Myo6 UTSW 9 80296665 missense probably damaging 0.99
R8161:Myo6 UTSW 9 80217709 missense unknown
R8245:Myo6 UTSW 9 80254947 missense unknown
R8375:Myo6 UTSW 9 80254924 missense unknown
R8387:Myo6 UTSW 9 80276350 missense unknown
R8467:Myo6 UTSW 9 80228886 missense probably damaging 1.00
R8669:Myo6 UTSW 9 80266249 missense unknown
R8770:Myo6 UTSW 9 80264199 missense unknown
R8807:Myo6 UTSW 9 80300667 critical splice donor site probably null
Z1191:Myo6 UTSW 9 80242227 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCATGATTGGACAAGGTATTTCTG -3'
(R):5'- TGCTGAACTTCGAGCACTTGC -3'

Sequencing Primer
(F):5'- CTGATACCTAATTTTAGTGCCTGAC -3'
(R):5'- ACCTGGCCACCTCATGTCAG -3'
Posted On2019-09-13