Incidental Mutation 'R7399:Bcap29'
ID574052
Institutional Source Beutler Lab
Gene Symbol Bcap29
Ensembl Gene ENSMUSG00000020650
Gene NameB cell receptor associated protein 29
SynonymsBap29
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.133) question?
Stock #R7399 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location31590967-31634658 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 31630882 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 35 (I35T)
Ref Sequence ENSEMBL: ENSMUSP00000020979 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020979] [ENSMUST00000177962]
Predicted Effect probably damaging
Transcript: ENSMUST00000020979
AA Change: I35T

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000020979
Gene: ENSMUSG00000020650
AA Change: I35T

DomainStartEndE-ValueType
Pfam:Bap31 1 219 9.2e-62 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000177962
AA Change: I35T

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000137260
Gene: ENSMUSG00000020650
AA Change: I35T

DomainStartEndE-ValueType
Pfam:Bap31 1 219 4.3e-70 PFAM
Meta Mutation Damage Score 0.5983 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (74/75)
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T G 11: 84,260,679 V801G possibly damaging Het
Actbl2 T A 13: 111,255,593 M154K probably benign Het
Adam7 A T 14: 68,504,466 probably null Het
Arfgef1 T A 1: 10,180,897 T888S probably benign Het
AW554918 C T 18: 25,169,060 P10L possibly damaging Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
C87499 C A 4: 88,627,965 R380L probably benign Het
Cdc25b A G 2: 131,194,654 D458G probably damaging Het
Cdc42bpb T C 12: 111,305,667 K1104R probably benign Het
Cep89 A G 7: 35,438,378 N729S probably damaging Het
Clec4a4 T A 6: 122,991,829 M51K possibly damaging Het
Dcdc2b A G 4: 129,609,629 L270P probably damaging Het
Dennd5b G T 6: 149,036,483 H639N probably damaging Het
Dnah11 T C 12: 118,125,785 E1182G probably damaging Het
Dnah11 T G 12: 118,027,477 T2385P probably benign Het
Dok7 T C 5: 35,066,471 V81A probably damaging Het
Dtx1 T A 5: 120,682,393 M494L possibly damaging Het
Foxj1 A T 11: 116,332,254 L241Q possibly damaging Het
Gbp10 G A 5: 105,236,149 probably benign Het
Hnmt T A 2: 24,003,880 T201S probably benign Het
Jup G T 11: 100,378,351 T412K possibly damaging Het
Kcnh2 G A 5: 24,322,059 S954F probably damaging Het
Klhdc7b A C 15: 89,388,644 K585T possibly damaging Het
Klk7 T A 7: 43,812,000 S14T probably benign Het
Lama4 G A 10: 39,047,948 E451K probably damaging Het
Ldhb A G 6: 142,495,673 C164R probably damaging Het
Malrd1 G A 2: 15,610,090 D239N Het
Mgam T A 6: 40,666,854 V572E probably damaging Het
Mrgprb2 G T 7: 48,552,142 N278K probably damaging Het
Msto1 A G 3: 88,911,823 Y206H probably damaging Het
Myo6 A G 9: 80,262,291 S467G unknown Het
Mysm1 T A 4: 94,961,727 I447L probably benign Het
Nav3 T C 10: 109,852,934 E494G possibly damaging Het
Nol10 T G 12: 17,402,173 V376G probably damaging Het
Nup205 T A 6: 35,214,676 I1032N probably damaging Het
Olfr1002 T A 2: 85,647,424 D299V possibly damaging Het
Olfr1100 G A 2: 86,978,157 T213I probably benign Het
Olfr1170 A T 2: 88,225,022 Y3* probably null Het
Olfr1450 A G 19: 12,954,447 N286S probably damaging Het
Olfr449 T G 6: 42,838,746 Y288* probably null Het
Olfr455 A G 6: 42,538,728 F98S possibly damaging Het
Olfr617 A T 7: 103,584,381 I120L possibly damaging Het
Olfr782 A T 10: 129,350,557 probably benign Het
Olfr996 A G 2: 85,579,296 D19G probably benign Het
Oog2 A G 4: 144,195,281 K254E probably benign Het
Osbpl11 T A 16: 33,236,279 D694E probably benign Het
Pcm1 T A 8: 41,293,510 Y1210N probably benign Het
Pdxk T C 10: 78,440,863 M293V probably benign Het
Plcb3 T C 19: 6,962,867 I451V probably benign Het
Plekhm2 A G 4: 141,634,376 F272S probably damaging Het
Ptgdr A T 14: 44,858,232 probably null Het
Ptprf C T 4: 118,226,523 V788I probably benign Het
Ralbp1 C T 17: 65,854,148 V467I probably benign Het
Ralgds A C 2: 28,543,655 Q229P possibly damaging Het
Recql T C 6: 142,374,884 D146G probably damaging Het
Reln T C 5: 22,051,367 N493S probably damaging Het
Rfxank C T 8: 70,135,286 probably null Het
Scn5a A T 9: 119,486,530 M1704K probably damaging Het
Slc7a7 G T 14: 54,374,268 A316E possibly damaging Het
Slco1a6 A T 6: 142,091,068 C538S probably benign Het
Spert A G 14: 75,592,637 S39P probably benign Het
Stard6 T C 18: 70,498,647 probably null Het
Strip2 T A 6: 29,927,613 M219K possibly damaging Het
Tcam1 T C 11: 106,284,085 V122A probably damaging Het
Tha1 A G 11: 117,869,690 V236A possibly damaging Het
Tmem201 A T 4: 149,731,097 I132N possibly damaging Het
Tnc T C 4: 64,020,657 probably benign Het
Vmn1r42 T C 6: 89,845,513 T25A probably benign Het
Vmn2r94 T A 17: 18,244,503 probably null Het
Wdfy4 A C 14: 33,068,906 V2188G Het
Zfp623 T C 15: 75,947,398 S68P probably damaging Het
Zfp950 A T 19: 61,119,155 C497S probably damaging Het
Zkscan2 C T 7: 123,480,104 E877K probably damaging Het
Zp3r C A 1: 130,577,053 V536L probably damaging Het
Other mutations in Bcap29
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00419:Bcap29 APN 12 31630872 missense probably benign 0.02
IGL00537:Bcap29 APN 12 31617096 nonsense probably null
R1328:Bcap29 UTSW 12 31630808 missense probably benign 0.02
R1735:Bcap29 UTSW 12 31630840 missense probably damaging 1.00
R3703:Bcap29 UTSW 12 31617152 missense probably benign 0.00
R3704:Bcap29 UTSW 12 31617152 missense probably benign 0.00
R3705:Bcap29 UTSW 12 31617152 missense probably benign 0.00
R3871:Bcap29 UTSW 12 31617081 missense probably benign 0.07
R4628:Bcap29 UTSW 12 31626807 missense probably benign
R4832:Bcap29 UTSW 12 31624203 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- ATCACTGCACCTGAAATTTGAG -3'
(R):5'- GTTCTGCTCATCGTGAAAAGG -3'

Sequencing Primer
(F):5'- CTGGATTCAAAGGAGGAATGTA -3'
(R):5'- CCTGGTCTACAGTTCTGGAATGAC -3'
Posted On2019-09-13