Incidental Mutation 'R7399:Cdc42bpb'
ID574053
Institutional Source Beutler Lab
Gene Symbol Cdc42bpb
Ensembl Gene ENSMUSG00000021279
Gene NameCDC42 binding protein kinase beta
SynonymsDMPK-like
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.754) question?
Stock #R7399 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location111292976-111377718 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 111305667 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 1104 (K1104R)
Ref Sequence ENSEMBL: ENSMUSP00000042565 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041965]
Predicted Effect probably benign
Transcript: ENSMUST00000041965
AA Change: K1104R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000042565
Gene: ENSMUSG00000021279
AA Change: K1104R

DomainStartEndE-ValueType
S_TKc 76 342 1e-87 SMART
S_TK_X 343 405 5.02e-10 SMART
Pfam:KELK 527 606 4.5e-32 PFAM
low complexity region 628 640 N/A INTRINSIC
coiled coil region 727 815 N/A INTRINSIC
low complexity region 843 859 N/A INTRINSIC
Pfam:DMPK_coil 878 939 1.2e-29 PFAM
C1 1027 1076 1.43e-11 SMART
PH 1097 1217 1.19e-6 SMART
CNH 1240 1521 1.32e-10 SMART
low complexity region 1564 1576 N/A INTRINSIC
PBD 1585 1620 7.16e-10 SMART
low complexity region 1681 1696 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000222724
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the serine/threonine protein kinase family. The encoded protein contains a Cdc42/Rac-binding p21 binding domain resembling that of PAK kinase. The kinase domain of this protein is most closely related to that of myotonic dystrophy kinase-related ROK. Studies of the similar gene in rat suggested that this kinase may act as a downstream effector of Cdc42 in cytoskeletal reorganization. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T G 11: 84,260,679 V801G possibly damaging Het
Actbl2 T A 13: 111,255,593 M154K probably benign Het
Adam7 A T 14: 68,504,466 probably null Het
Arfgef1 T A 1: 10,180,897 T888S probably benign Het
AW554918 C T 18: 25,169,060 P10L possibly damaging Het
Bcap29 A G 12: 31,630,882 I35T probably damaging Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
C87499 C A 4: 88,627,965 R380L probably benign Het
Cdc25b A G 2: 131,194,654 D458G probably damaging Het
Cep89 A G 7: 35,438,378 N729S probably damaging Het
Clec4a4 T A 6: 122,991,829 M51K possibly damaging Het
Dcdc2b A G 4: 129,609,629 L270P probably damaging Het
Dennd5b G T 6: 149,036,483 H639N probably damaging Het
Dnah11 T G 12: 118,027,477 T2385P probably benign Het
Dnah11 T C 12: 118,125,785 E1182G probably damaging Het
Dok7 T C 5: 35,066,471 V81A probably damaging Het
Dtx1 T A 5: 120,682,393 M494L possibly damaging Het
Foxj1 A T 11: 116,332,254 L241Q possibly damaging Het
Gbp10 G A 5: 105,236,149 probably benign Het
Hnmt T A 2: 24,003,880 T201S probably benign Het
Jup G T 11: 100,378,351 T412K possibly damaging Het
Kcnh2 G A 5: 24,322,059 S954F probably damaging Het
Klhdc7b A C 15: 89,388,644 K585T possibly damaging Het
Klk7 T A 7: 43,812,000 S14T probably benign Het
Lama4 G A 10: 39,047,948 E451K probably damaging Het
Ldhb A G 6: 142,495,673 C164R probably damaging Het
Malrd1 G A 2: 15,610,090 D239N Het
Mgam T A 6: 40,666,854 V572E probably damaging Het
Mrgprb2 G T 7: 48,552,142 N278K probably damaging Het
Msto1 A G 3: 88,911,823 Y206H probably damaging Het
Myo6 A G 9: 80,262,291 S467G unknown Het
Mysm1 T A 4: 94,961,727 I447L probably benign Het
Nav3 T C 10: 109,852,934 E494G possibly damaging Het
Nol10 T G 12: 17,402,173 V376G probably damaging Het
Nup205 T A 6: 35,214,676 I1032N probably damaging Het
Olfr1002 T A 2: 85,647,424 D299V possibly damaging Het
Olfr1100 G A 2: 86,978,157 T213I probably benign Het
Olfr1170 A T 2: 88,225,022 Y3* probably null Het
Olfr1450 A G 19: 12,954,447 N286S probably damaging Het
Olfr449 T G 6: 42,838,746 Y288* probably null Het
Olfr455 A G 6: 42,538,728 F98S possibly damaging Het
Olfr617 A T 7: 103,584,381 I120L possibly damaging Het
Olfr782 A T 10: 129,350,557 probably benign Het
Olfr996 A G 2: 85,579,296 D19G probably benign Het
Oog2 A G 4: 144,195,281 K254E probably benign Het
Osbpl11 T A 16: 33,236,279 D694E probably benign Het
Pcm1 T A 8: 41,293,510 Y1210N probably benign Het
Pdxk T C 10: 78,440,863 M293V probably benign Het
Plcb3 T C 19: 6,962,867 I451V probably benign Het
Plekhm2 A G 4: 141,634,376 F272S probably damaging Het
Ptgdr A T 14: 44,858,232 probably null Het
Ptprf C T 4: 118,226,523 V788I probably benign Het
Ralbp1 C T 17: 65,854,148 V467I probably benign Het
Ralgds A C 2: 28,543,655 Q229P possibly damaging Het
Recql T C 6: 142,374,884 D146G probably damaging Het
Reln T C 5: 22,051,367 N493S probably damaging Het
Rfxank C T 8: 70,135,286 probably null Het
Scn5a A T 9: 119,486,530 M1704K probably damaging Het
Slc7a7 G T 14: 54,374,268 A316E possibly damaging Het
Slco1a6 A T 6: 142,091,068 C538S probably benign Het
Spert A G 14: 75,592,637 S39P probably benign Het
Stard6 T C 18: 70,498,647 probably null Het
Strip2 T A 6: 29,927,613 M219K possibly damaging Het
Tcam1 T C 11: 106,284,085 V122A probably damaging Het
Tha1 A G 11: 117,869,690 V236A possibly damaging Het
Tmem201 A T 4: 149,731,097 I132N possibly damaging Het
Tnc T C 4: 64,020,657 probably benign Het
Vmn1r42 T C 6: 89,845,513 T25A probably benign Het
Vmn2r94 T A 17: 18,244,503 probably null Het
Wdfy4 A C 14: 33,068,906 V2188G Het
Zfp623 T C 15: 75,947,398 S68P probably damaging Het
Zfp950 A T 19: 61,119,155 C497S probably damaging Het
Zkscan2 C T 7: 123,480,104 E877K probably damaging Het
Zp3r C A 1: 130,577,053 V536L probably damaging Het
Other mutations in Cdc42bpb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01335:Cdc42bpb APN 12 111294096 unclassified probably benign
IGL01360:Cdc42bpb APN 12 111342075 missense probably damaging 1.00
IGL01577:Cdc42bpb APN 12 111302043 missense possibly damaging 0.71
IGL01909:Cdc42bpb APN 12 111323142 missense probably benign
IGL01924:Cdc42bpb APN 12 111317453 unclassified probably benign
IGL02428:Cdc42bpb APN 12 111323127 missense probably benign
IGL02678:Cdc42bpb APN 12 111326096 missense probably damaging 1.00
IGL02792:Cdc42bpb APN 12 111299561 missense probably benign
IGL03367:Cdc42bpb APN 12 111336159 missense probably damaging 1.00
F5770:Cdc42bpb UTSW 12 111296391 missense probably benign 0.28
PIT4585001:Cdc42bpb UTSW 12 111304978 missense probably damaging 1.00
R0129:Cdc42bpb UTSW 12 111304959 intron probably benign
R0633:Cdc42bpb UTSW 12 111345555 missense probably damaging 0.99
R1054:Cdc42bpb UTSW 12 111313353 missense probably benign 0.00
R1335:Cdc42bpb UTSW 12 111296441 missense probably damaging 1.00
R1459:Cdc42bpb UTSW 12 111296300 unclassified probably benign
R1780:Cdc42bpb UTSW 12 111322907 missense probably damaging 1.00
R1823:Cdc42bpb UTSW 12 111327559 missense probably damaging 1.00
R1843:Cdc42bpb UTSW 12 111322821 missense probably benign
R1902:Cdc42bpb UTSW 12 111326016 missense probably damaging 1.00
R1945:Cdc42bpb UTSW 12 111299133 missense probably damaging 1.00
R2077:Cdc42bpb UTSW 12 111299196 missense probably damaging 1.00
R2184:Cdc42bpb UTSW 12 111296044 missense probably damaging 0.99
R2208:Cdc42bpb UTSW 12 111336029 missense probably damaging 1.00
R2211:Cdc42bpb UTSW 12 111301854 missense probably benign 0.11
R2273:Cdc42bpb UTSW 12 111302167 missense probably damaging 1.00
R2406:Cdc42bpb UTSW 12 111302124 missense probably benign 0.00
R3080:Cdc42bpb UTSW 12 111295818 missense probably damaging 0.99
R3612:Cdc42bpb UTSW 12 111303822 intron probably benign
R4106:Cdc42bpb UTSW 12 111295145 missense probably benign 0.01
R4133:Cdc42bpb UTSW 12 111321542 missense probably benign 0.00
R4156:Cdc42bpb UTSW 12 111294139 missense probably benign 0.17
R4202:Cdc42bpb UTSW 12 111294139 missense probably benign 0.17
R4573:Cdc42bpb UTSW 12 111323141 missense probably benign 0.00
R4659:Cdc42bpb UTSW 12 111339891 missense probably damaging 1.00
R5101:Cdc42bpb UTSW 12 111299115 missense probably damaging 1.00
R5591:Cdc42bpb UTSW 12 111323087 missense probably benign 0.01
R5669:Cdc42bpb UTSW 12 111302013 critical splice donor site probably null
R5830:Cdc42bpb UTSW 12 111345582 nonsense probably null
R5872:Cdc42bpb UTSW 12 111325976 missense probably damaging 1.00
R6748:Cdc42bpb UTSW 12 111294839 unclassified probably benign
R6813:Cdc42bpb UTSW 12 111327615 missense probably damaging 1.00
R7024:Cdc42bpb UTSW 12 111326085 missense probably damaging 1.00
R7165:Cdc42bpb UTSW 12 111321517 missense probably damaging 1.00
R7228:Cdc42bpb UTSW 12 111305093 missense possibly damaging 0.92
R7258:Cdc42bpb UTSW 12 111326084 missense probably damaging 1.00
R7352:Cdc42bpb UTSW 12 111299311 missense probably damaging 1.00
R7361:Cdc42bpb UTSW 12 111345605 missense probably damaging 1.00
R7468:Cdc42bpb UTSW 12 111339873 missense probably damaging 1.00
R7622:Cdc42bpb UTSW 12 111294772 missense unknown
R7648:Cdc42bpb UTSW 12 111377153 missense probably damaging 1.00
R7734:Cdc42bpb UTSW 12 111329230 missense probably damaging 1.00
R7783:Cdc42bpb UTSW 12 111336025 critical splice donor site probably null
R8738:Cdc42bpb UTSW 12 111307787 missense probably benign 0.42
V7582:Cdc42bpb UTSW 12 111296391 missense probably benign 0.28
V7583:Cdc42bpb UTSW 12 111296391 missense probably benign 0.28
X0023:Cdc42bpb UTSW 12 111326078 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCATGTCCAAAGGGTCTCTC -3'
(R):5'- CAAAACACCCTCTTGTGCTCTG -3'

Sequencing Primer
(F):5'- CGGGTTCTTAGCCATTTACAGCAG -3'
(R):5'- CTACGGGTCTTGAGCATGC -3'
Posted On2019-09-13