Incidental Mutation 'R7399:Wdfy4'
ID 574057
Institutional Source Beutler Lab
Gene Symbol Wdfy4
Ensembl Gene ENSMUSG00000051506
Gene Name WD repeat and FYVE domain containing 4
Synonyms
MMRRC Submission 045481-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7399 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 32681504-32907465 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 32790863 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glycine at position 2188 (V2188G)
Ref Sequence ENSEMBL: ENSMUSP00000117068 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061753] [ENSMUST00000130509]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000061753
AA Change: V2034G

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000057556
Gene: ENSMUSG00000051506
AA Change: V2034G

DomainStartEndE-ValueType
low complexity region 69 77 N/A INTRINSIC
low complexity region 204 222 N/A INTRINSIC
low complexity region 508 522 N/A INTRINSIC
low complexity region 618 632 N/A INTRINSIC
low complexity region 644 661 N/A INTRINSIC
low complexity region 1585 1604 N/A INTRINSIC
low complexity region 1899 1909 N/A INTRINSIC
Pfam:PH_BEACH 2237 2348 1.2e-9 PFAM
Beach 2378 2660 3.69e-196 SMART
WD40 2761 2801 1.98e1 SMART
WD40 2811 2850 5.18e-7 SMART
WD40 2853 2891 9.94e-1 SMART
WD40 2893 2940 3.17e-2 SMART
WD40 2986 3021 3.31e0 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000117068
Gene: ENSMUSG00000051506
AA Change: V2188G

DomainStartEndE-ValueType
low complexity region 69 77 N/A INTRINSIC
low complexity region 204 222 N/A INTRINSIC
low complexity region 508 522 N/A INTRINSIC
low complexity region 618 632 N/A INTRINSIC
low complexity region 644 661 N/A INTRINSIC
low complexity region 1596 1615 N/A INTRINSIC
low complexity region 1795 1819 N/A INTRINSIC
low complexity region 2019 2029 N/A INTRINSIC
Pfam:PH_BEACH 2362 2473 1.2e-9 PFAM
Beach 2503 2785 3.69e-196 SMART
WD40 2886 2926 1.98e1 SMART
WD40 2936 2975 5.18e-7 SMART
WD40 2978 3016 9.94e-1 SMART
WD40 3018 3065 3.17e-2 SMART
WD40 3111 3146 3.31e0 SMART
Meta Mutation Damage Score 0.0909 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (74/75)
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T G 11: 84,151,505 (GRCm39) V801G possibly damaging Het
Actbl2 T A 13: 111,392,127 (GRCm39) M154K probably benign Het
Adam7 A T 14: 68,741,915 (GRCm39) probably null Het
Arfgef1 T A 1: 10,251,122 (GRCm39) T888S probably benign Het
AW554918 C T 18: 25,302,117 (GRCm39) P10L possibly damaging Het
Bcap29 A G 12: 31,680,881 (GRCm39) I35T probably damaging Het
Bhlhe40 TG TGG 6: 108,641,818 (GRCm39) 254 probably null Het
Cby2 A G 14: 75,830,077 (GRCm39) S39P probably benign Het
Cdc25b A G 2: 131,036,574 (GRCm39) D458G probably damaging Het
Cdc42bpb T C 12: 111,272,101 (GRCm39) K1104R probably benign Het
Cep89 A G 7: 35,137,803 (GRCm39) N729S probably damaging Het
Clec4a4 T A 6: 122,968,788 (GRCm39) M51K possibly damaging Het
Dcdc2b A G 4: 129,503,422 (GRCm39) L270P probably damaging Het
Dennd5b G T 6: 148,937,981 (GRCm39) H639N probably damaging Het
Dnah11 T G 12: 117,991,212 (GRCm39) T2385P probably benign Het
Dnah11 T C 12: 118,089,520 (GRCm39) E1182G probably damaging Het
Dok7 T C 5: 35,223,815 (GRCm39) V81A probably damaging Het
Dtx1 T A 5: 120,820,458 (GRCm39) M494L possibly damaging Het
Foxj1 A T 11: 116,223,080 (GRCm39) L241Q possibly damaging Het
Gbp10 G A 5: 105,384,015 (GRCm39) probably benign Het
Hnmt T A 2: 23,893,892 (GRCm39) T201S probably benign Het
Jup G T 11: 100,269,177 (GRCm39) T412K possibly damaging Het
Kcnh2 G A 5: 24,527,057 (GRCm39) S954F probably damaging Het
Klhdc7b A C 15: 89,272,847 (GRCm39) K585T possibly damaging Het
Klk7 T A 7: 43,461,424 (GRCm39) S14T probably benign Het
Lama4 G A 10: 38,923,944 (GRCm39) E451K probably damaging Het
Ldhb A G 6: 142,441,399 (GRCm39) C164R probably damaging Het
Malrd1 G A 2: 15,614,901 (GRCm39) D239N Het
Mgam T A 6: 40,643,788 (GRCm39) V572E probably damaging Het
Mrgprb2 G T 7: 48,201,890 (GRCm39) N278K probably damaging Het
Msto1 A G 3: 88,819,130 (GRCm39) Y206H probably damaging Het
Myo6 A G 9: 80,169,573 (GRCm39) S467G unknown Het
Mysm1 T A 4: 94,849,964 (GRCm39) I447L probably benign Het
Nav3 T C 10: 109,688,795 (GRCm39) E494G possibly damaging Het
Nol10 T G 12: 17,452,174 (GRCm39) V376G probably damaging Het
Nup205 T A 6: 35,191,611 (GRCm39) I1032N probably damaging Het
Oog2 A G 4: 143,921,851 (GRCm39) K254E probably benign Het
Or10ac1 A G 6: 42,515,662 (GRCm39) F98S possibly damaging Het
Or52z12 A T 7: 103,233,588 (GRCm39) I120L possibly damaging Het
Or5b98 A G 19: 12,931,811 (GRCm39) N286S probably damaging Het
Or5d41 A T 2: 88,055,366 (GRCm39) Y3* probably null Het
Or5g25 T A 2: 85,477,768 (GRCm39) D299V possibly damaging Het
Or5g27 A G 2: 85,409,640 (GRCm39) D19G probably benign Het
Or6b1 T G 6: 42,815,680 (GRCm39) Y288* probably null Het
Or6c6 A T 10: 129,186,426 (GRCm39) probably benign Het
Or8h10 G A 2: 86,808,501 (GRCm39) T213I probably benign Het
Osbpl11 T A 16: 33,056,649 (GRCm39) D694E probably benign Het
Pcm1 T A 8: 41,746,547 (GRCm39) Y1210N probably benign Het
Pdxk T C 10: 78,276,697 (GRCm39) M293V probably benign Het
Plcb3 T C 19: 6,940,235 (GRCm39) I451V probably benign Het
Plekhm2 A G 4: 141,361,687 (GRCm39) F272S probably damaging Het
Pramel32 C A 4: 88,546,202 (GRCm39) R380L probably benign Het
Ptgdr A T 14: 45,095,689 (GRCm39) probably null Het
Ptprf C T 4: 118,083,720 (GRCm39) V788I probably benign Het
Ralbp1 C T 17: 66,161,143 (GRCm39) V467I probably benign Het
Ralgds A C 2: 28,433,667 (GRCm39) Q229P possibly damaging Het
Recql T C 6: 142,320,610 (GRCm39) D146G probably damaging Het
Reln T C 5: 22,256,365 (GRCm39) N493S probably damaging Het
Rfxank C T 8: 70,587,936 (GRCm39) probably null Het
Scn5a A T 9: 119,315,596 (GRCm39) M1704K probably damaging Het
Slc7a7 G T 14: 54,611,725 (GRCm39) A316E possibly damaging Het
Slco1a6 A T 6: 142,036,794 (GRCm39) C538S probably benign Het
Stard6 T C 18: 70,631,718 (GRCm39) probably null Het
Strip2 T A 6: 29,927,612 (GRCm39) M219K possibly damaging Het
Tcam1 T C 11: 106,174,911 (GRCm39) V122A probably damaging Het
Tha1 A G 11: 117,760,516 (GRCm39) V236A possibly damaging Het
Tmem201 A T 4: 149,815,554 (GRCm39) I132N possibly damaging Het
Tnc T C 4: 63,938,894 (GRCm39) probably benign Het
Vmn1r42 T C 6: 89,822,495 (GRCm39) T25A probably benign Het
Vmn2r94 T A 17: 18,464,765 (GRCm39) probably null Het
Zfp623 T C 15: 75,819,247 (GRCm39) S68P probably damaging Het
Zfp950 A T 19: 61,107,593 (GRCm39) C497S probably damaging Het
Zkscan2 C T 7: 123,079,327 (GRCm39) E877K probably damaging Het
Zp3r C A 1: 130,504,790 (GRCm39) V536L probably damaging Het
Other mutations in Wdfy4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Wdfy4 APN 14 32,824,496 (GRCm39) missense possibly damaging 0.93
IGL01116:Wdfy4 APN 14 32,681,934 (GRCm39) missense probably damaging 1.00
IGL01449:Wdfy4 APN 14 32,825,994 (GRCm39) missense probably damaging 0.99
IGL01567:Wdfy4 APN 14 32,873,618 (GRCm39) missense probably benign 0.01
IGL01700:Wdfy4 APN 14 32,742,195 (GRCm39) splice site probably benign
IGL01931:Wdfy4 APN 14 32,877,710 (GRCm39) missense probably damaging 1.00
IGL01981:Wdfy4 APN 14 32,855,673 (GRCm39) missense probably damaging 1.00
IGL01988:Wdfy4 APN 14 32,798,437 (GRCm39) missense possibly damaging 0.75
IGL02026:Wdfy4 APN 14 32,815,257 (GRCm39) missense probably damaging 1.00
IGL02066:Wdfy4 APN 14 32,871,523 (GRCm39) missense probably benign
IGL02468:Wdfy4 APN 14 32,688,389 (GRCm39) missense probably benign 0.01
IGL02512:Wdfy4 APN 14 32,764,448 (GRCm39) missense probably benign 0.01
IGL02597:Wdfy4 APN 14 32,812,818 (GRCm39) nonsense probably null
IGL02752:Wdfy4 APN 14 32,798,283 (GRCm39) missense probably damaging 1.00
IGL02792:Wdfy4 APN 14 32,817,262 (GRCm39) missense probably benign 0.01
IGL02826:Wdfy4 APN 14 32,693,707 (GRCm39) missense possibly damaging 0.47
IGL02903:Wdfy4 APN 14 32,831,607 (GRCm39) missense probably damaging 1.00
IGL02955:Wdfy4 APN 14 32,798,241 (GRCm39) missense probably damaging 1.00
IGL03031:Wdfy4 APN 14 32,862,608 (GRCm39) missense probably damaging 1.00
IGL03102:Wdfy4 APN 14 32,688,392 (GRCm39) missense probably damaging 1.00
IGL03123:Wdfy4 APN 14 32,884,827 (GRCm39) missense probably benign 0.01
IGL03198:Wdfy4 APN 14 32,847,844 (GRCm39) missense probably damaging 1.00
IGL03250:Wdfy4 APN 14 32,699,124 (GRCm39) missense probably damaging 0.99
IGL03277:Wdfy4 APN 14 32,790,861 (GRCm39) missense probably benign 0.01
IGL03398:Wdfy4 APN 14 32,769,247 (GRCm39) missense probably benign 0.14
dodgers UTSW 14 32,699,063 (GRCm39) nonsense probably null
Dollar UTSW 14 32,742,268 (GRCm39) missense probably damaging 1.00
Giants UTSW 14 32,792,575 (GRCm39) nonsense probably null
gigantea UTSW 14 32,696,111 (GRCm39) critical splice donor site probably null
kings_canyon UTSW 14 32,831,476 (GRCm39) nonsense probably null
moro UTSW 14 32,686,583 (GRCm39) splice site probably null
popped UTSW 14 32,688,356 (GRCm39) missense probably damaging 0.99
sequoia UTSW 14 32,822,860 (GRCm39) critical splice donor site probably null
Sherman UTSW 14 32,817,908 (GRCm39) missense possibly damaging 0.89
stretched UTSW 14 32,795,492 (GRCm39) nonsense probably null
watchtower UTSW 14 32,805,596 (GRCm39) critical splice donor site probably null
R0014:Wdfy4 UTSW 14 32,829,130 (GRCm39) missense possibly damaging 0.72
R0067:Wdfy4 UTSW 14 32,884,708 (GRCm39) missense probably null 1.00
R0085:Wdfy4 UTSW 14 32,800,200 (GRCm39) missense possibly damaging 0.81
R0277:Wdfy4 UTSW 14 32,805,742 (GRCm39) missense possibly damaging 0.83
R0436:Wdfy4 UTSW 14 32,805,769 (GRCm39) splice site probably benign
R0496:Wdfy4 UTSW 14 32,862,695 (GRCm39) splice site probably benign
R0514:Wdfy4 UTSW 14 32,802,732 (GRCm39) missense probably benign 0.22
R0548:Wdfy4 UTSW 14 32,764,578 (GRCm39) missense probably benign
R0590:Wdfy4 UTSW 14 32,763,131 (GRCm39) missense probably benign 0.09
R0647:Wdfy4 UTSW 14 32,831,656 (GRCm39) missense possibly damaging 0.96
R0766:Wdfy4 UTSW 14 32,862,569 (GRCm39) missense probably damaging 1.00
R0981:Wdfy4 UTSW 14 32,869,049 (GRCm39) missense probably benign 0.03
R1024:Wdfy4 UTSW 14 32,801,923 (GRCm39) missense possibly damaging 0.81
R1113:Wdfy4 UTSW 14 32,693,695 (GRCm39) missense possibly damaging 0.47
R1252:Wdfy4 UTSW 14 32,693,729 (GRCm39) splice site probably null
R1415:Wdfy4 UTSW 14 32,763,137 (GRCm39) missense possibly damaging 0.60
R1475:Wdfy4 UTSW 14 32,830,645 (GRCm39) missense probably benign 0.14
R1483:Wdfy4 UTSW 14 32,822,923 (GRCm39) missense probably benign 0.41
R1490:Wdfy4 UTSW 14 32,874,495 (GRCm39) critical splice donor site probably null
R1512:Wdfy4 UTSW 14 32,682,765 (GRCm39) missense probably damaging 0.98
R1615:Wdfy4 UTSW 14 32,764,469 (GRCm39) missense probably damaging 1.00
R1628:Wdfy4 UTSW 14 32,681,918 (GRCm39) missense probably damaging 1.00
R1643:Wdfy4 UTSW 14 32,795,542 (GRCm39) critical splice acceptor site probably null
R1729:Wdfy4 UTSW 14 32,817,962 (GRCm39) missense possibly damaging 0.85
R1859:Wdfy4 UTSW 14 32,825,940 (GRCm39) missense probably damaging 0.99
R1933:Wdfy4 UTSW 14 32,855,301 (GRCm39) missense probably benign 0.08
R1957:Wdfy4 UTSW 14 32,693,641 (GRCm39) missense probably damaging 1.00
R1968:Wdfy4 UTSW 14 32,828,001 (GRCm39) missense possibly damaging 0.95
R2032:Wdfy4 UTSW 14 32,868,946 (GRCm39) missense probably benign 0.11
R2241:Wdfy4 UTSW 14 32,795,468 (GRCm39) missense possibly damaging 0.81
R2391:Wdfy4 UTSW 14 32,884,764 (GRCm39) missense possibly damaging 0.92
R2888:Wdfy4 UTSW 14 32,831,476 (GRCm39) nonsense probably null
R2889:Wdfy4 UTSW 14 32,831,476 (GRCm39) nonsense probably null
R3114:Wdfy4 UTSW 14 32,811,860 (GRCm39) missense probably damaging 0.97
R3757:Wdfy4 UTSW 14 32,745,331 (GRCm39) missense probably benign 0.17
R3758:Wdfy4 UTSW 14 32,745,331 (GRCm39) missense probably benign 0.17
R3797:Wdfy4 UTSW 14 32,862,602 (GRCm39) missense probably damaging 1.00
R3890:Wdfy4 UTSW 14 32,769,237 (GRCm39) missense probably damaging 1.00
R3892:Wdfy4 UTSW 14 32,769,237 (GRCm39) missense probably damaging 1.00
R3945:Wdfy4 UTSW 14 32,688,352 (GRCm39) missense probably damaging 0.99
R4011:Wdfy4 UTSW 14 32,824,637 (GRCm39) splice site probably benign
R4091:Wdfy4 UTSW 14 32,847,837 (GRCm39) missense possibly damaging 0.93
R4449:Wdfy4 UTSW 14 32,818,040 (GRCm39) missense probably damaging 1.00
R4585:Wdfy4 UTSW 14 32,809,912 (GRCm39) missense possibly damaging 0.89
R4628:Wdfy4 UTSW 14 32,824,515 (GRCm39) missense probably damaging 0.97
R4629:Wdfy4 UTSW 14 32,824,515 (GRCm39) missense probably damaging 0.97
R4655:Wdfy4 UTSW 14 32,711,893 (GRCm39) missense probably damaging 0.98
R4689:Wdfy4 UTSW 14 32,831,505 (GRCm39) missense possibly damaging 0.88
R4718:Wdfy4 UTSW 14 32,867,273 (GRCm39) missense probably benign 0.03
R4862:Wdfy4 UTSW 14 32,822,860 (GRCm39) critical splice donor site probably null
R4884:Wdfy4 UTSW 14 32,710,852 (GRCm39) nonsense probably null
R4894:Wdfy4 UTSW 14 32,877,717 (GRCm39) missense probably benign 0.03
R4929:Wdfy4 UTSW 14 32,769,213 (GRCm39) missense possibly damaging 0.90
R4932:Wdfy4 UTSW 14 32,750,970 (GRCm39) missense probably damaging 1.00
R5014:Wdfy4 UTSW 14 32,822,897 (GRCm39) missense probably benign 0.02
R5020:Wdfy4 UTSW 14 32,801,892 (GRCm39) missense probably damaging 1.00
R5049:Wdfy4 UTSW 14 32,874,627 (GRCm39) missense possibly damaging 0.78
R5276:Wdfy4 UTSW 14 32,769,232 (GRCm39) missense probably damaging 1.00
R5318:Wdfy4 UTSW 14 32,800,300 (GRCm39) missense possibly damaging 0.95
R5338:Wdfy4 UTSW 14 32,812,823 (GRCm39) missense probably damaging 1.00
R5349:Wdfy4 UTSW 14 32,710,856 (GRCm39) missense probably damaging 1.00
R5411:Wdfy4 UTSW 14 32,681,959 (GRCm39) missense probably damaging 1.00
R5435:Wdfy4 UTSW 14 32,742,268 (GRCm39) missense probably damaging 1.00
R5463:Wdfy4 UTSW 14 32,873,689 (GRCm39) missense probably benign 0.17
R5591:Wdfy4 UTSW 14 32,829,087 (GRCm39) missense probably benign 0.09
R5598:Wdfy4 UTSW 14 32,855,454 (GRCm39) missense probably damaging 1.00
R5654:Wdfy4 UTSW 14 32,829,575 (GRCm39) splice site probably null
R5890:Wdfy4 UTSW 14 32,824,534 (GRCm39) missense possibly damaging 0.91
R5894:Wdfy4 UTSW 14 32,855,317 (GRCm39) missense possibly damaging 0.86
R5964:Wdfy4 UTSW 14 32,827,968 (GRCm39) missense probably damaging 1.00
R6036:Wdfy4 UTSW 14 32,868,947 (GRCm39) missense probably damaging 0.97
R6036:Wdfy4 UTSW 14 32,868,947 (GRCm39) missense probably damaging 0.97
R6074:Wdfy4 UTSW 14 32,805,596 (GRCm39) critical splice donor site probably null
R6135:Wdfy4 UTSW 14 32,693,668 (GRCm39) missense probably damaging 0.99
R6276:Wdfy4 UTSW 14 32,831,482 (GRCm39) missense possibly damaging 0.54
R6357:Wdfy4 UTSW 14 32,823,006 (GRCm39) nonsense probably null
R6370:Wdfy4 UTSW 14 32,790,807 (GRCm39) missense probably benign 0.16
R6390:Wdfy4 UTSW 14 32,826,051 (GRCm39) missense probably damaging 0.99
R6413:Wdfy4 UTSW 14 32,689,604 (GRCm39) missense probably damaging 1.00
R6450:Wdfy4 UTSW 14 32,830,649 (GRCm39) missense probably damaging 1.00
R6522:Wdfy4 UTSW 14 32,868,901 (GRCm39) missense probably damaging 0.98
R6657:Wdfy4 UTSW 14 32,769,208 (GRCm39) missense possibly damaging 0.70
R6761:Wdfy4 UTSW 14 32,817,908 (GRCm39) missense possibly damaging 0.89
R6763:Wdfy4 UTSW 14 32,764,469 (GRCm39) missense probably damaging 1.00
R6952:Wdfy4 UTSW 14 32,681,923 (GRCm39) missense probably damaging 1.00
R6985:Wdfy4 UTSW 14 32,821,074 (GRCm39) missense possibly damaging 0.68
R7024:Wdfy4 UTSW 14 32,686,583 (GRCm39) splice site probably null
R7101:Wdfy4 UTSW 14 32,682,777 (GRCm39) missense
R7114:Wdfy4 UTSW 14 32,693,531 (GRCm39) splice site probably null
R7139:Wdfy4 UTSW 14 32,873,535 (GRCm39) missense
R7255:Wdfy4 UTSW 14 32,696,239 (GRCm39) missense
R7324:Wdfy4 UTSW 14 32,769,271 (GRCm39) missense
R7379:Wdfy4 UTSW 14 32,873,566 (GRCm39) missense
R7408:Wdfy4 UTSW 14 32,800,264 (GRCm39) missense
R7410:Wdfy4 UTSW 14 32,696,191 (GRCm39) missense
R7411:Wdfy4 UTSW 14 32,828,088 (GRCm39) missense
R7412:Wdfy4 UTSW 14 32,871,541 (GRCm39) missense
R7445:Wdfy4 UTSW 14 32,792,575 (GRCm39) nonsense probably null
R7595:Wdfy4 UTSW 14 32,696,111 (GRCm39) critical splice donor site probably null
R7618:Wdfy4 UTSW 14 32,707,696 (GRCm39) missense
R7622:Wdfy4 UTSW 14 32,800,231 (GRCm39) missense
R7828:Wdfy4 UTSW 14 32,710,878 (GRCm39) missense possibly damaging 0.90
R7888:Wdfy4 UTSW 14 32,812,920 (GRCm39) missense
R7946:Wdfy4 UTSW 14 32,826,072 (GRCm39) missense
R7946:Wdfy4 UTSW 14 32,792,705 (GRCm39) missense
R7986:Wdfy4 UTSW 14 32,826,072 (GRCm39) missense
R7990:Wdfy4 UTSW 14 32,819,752 (GRCm39) missense
R8001:Wdfy4 UTSW 14 32,695,492 (GRCm39) critical splice donor site probably null
R8010:Wdfy4 UTSW 14 32,693,584 (GRCm39) missense
R8015:Wdfy4 UTSW 14 32,829,704 (GRCm39) missense
R8032:Wdfy4 UTSW 14 32,751,043 (GRCm39) nonsense probably null
R8041:Wdfy4 UTSW 14 32,875,965 (GRCm39) critical splice donor site probably null
R8090:Wdfy4 UTSW 14 32,826,072 (GRCm39) missense
R8092:Wdfy4 UTSW 14 32,826,072 (GRCm39) missense
R8112:Wdfy4 UTSW 14 32,826,072 (GRCm39) missense
R8114:Wdfy4 UTSW 14 32,826,072 (GRCm39) missense
R8115:Wdfy4 UTSW 14 32,826,072 (GRCm39) missense
R8117:Wdfy4 UTSW 14 32,826,072 (GRCm39) missense
R8117:Wdfy4 UTSW 14 32,699,063 (GRCm39) nonsense probably null
R8118:Wdfy4 UTSW 14 32,826,072 (GRCm39) missense
R8140:Wdfy4 UTSW 14 32,864,317 (GRCm39) missense
R8155:Wdfy4 UTSW 14 32,884,776 (GRCm39) missense
R8163:Wdfy4 UTSW 14 32,873,545 (GRCm39) missense
R8293:Wdfy4 UTSW 14 32,696,218 (GRCm39) missense
R8325:Wdfy4 UTSW 14 32,689,444 (GRCm39) missense
R8353:Wdfy4 UTSW 14 32,695,581 (GRCm39) missense probably benign
R8370:Wdfy4 UTSW 14 32,815,208 (GRCm39) missense
R8437:Wdfy4 UTSW 14 32,798,332 (GRCm39) missense
R8497:Wdfy4 UTSW 14 32,688,356 (GRCm39) missense probably damaging 0.99
R8545:Wdfy4 UTSW 14 32,800,258 (GRCm39) missense probably benign 0.01
R8671:Wdfy4 UTSW 14 32,693,722 (GRCm39) splice site probably benign
R8708:Wdfy4 UTSW 14 32,689,489 (GRCm39) missense
R8747:Wdfy4 UTSW 14 32,874,611 (GRCm39) missense
R8794:Wdfy4 UTSW 14 32,869,049 (GRCm39) missense probably benign 0.03
R8846:Wdfy4 UTSW 14 32,867,105 (GRCm39) missense
R8880:Wdfy4 UTSW 14 32,795,492 (GRCm39) nonsense probably null
R9109:Wdfy4 UTSW 14 32,760,704 (GRCm39) splice site probably null
R9131:Wdfy4 UTSW 14 32,819,807 (GRCm39) missense
R9309:Wdfy4 UTSW 14 32,817,313 (GRCm39) missense
R9349:Wdfy4 UTSW 14 32,875,996 (GRCm39) missense
R9451:Wdfy4 UTSW 14 32,855,518 (GRCm39) missense
R9563:Wdfy4 UTSW 14 32,692,833 (GRCm39) missense
R9587:Wdfy4 UTSW 14 32,769,230 (GRCm39) nonsense probably null
R9599:Wdfy4 UTSW 14 32,855,428 (GRCm39) missense
R9670:Wdfy4 UTSW 14 32,769,219 (GRCm39) missense
R9718:Wdfy4 UTSW 14 32,847,893 (GRCm39) missense
R9742:Wdfy4 UTSW 14 32,809,987 (GRCm39) missense
X0028:Wdfy4 UTSW 14 32,802,593 (GRCm39) missense probably benign
X0053:Wdfy4 UTSW 14 32,884,899 (GRCm39) start codon destroyed probably null 0.99
X0062:Wdfy4 UTSW 14 32,829,575 (GRCm39) splice site probably null
Z1177:Wdfy4 UTSW 14 32,809,942 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- GGCACTCAGAGATTGTGGAACG -3'
(R):5'- CAGGGTGAGCCTGCAGTTTATG -3'

Sequencing Primer
(F):5'- CTCAGAGATTGTGGAACGTGACTAC -3'
(R):5'- GCTTCTCTTTGGCAGAAGGG -3'
Posted On 2019-09-13