Incidental Mutation 'R7399:Ralbp1'
ID 574064
Institutional Source Beutler Lab
Gene Symbol Ralbp1
Ensembl Gene ENSMUSG00000024096
Gene Name ralA binding protein 1
Synonyms RLIP76, Rip1
MMRRC Submission 045481-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.708) question?
Stock # R7399 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 66155410-66192750 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 66161143 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 467 (V467I)
Ref Sequence ENSEMBL: ENSMUSP00000024905 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024905] [ENSMUST00000166543]
AlphaFold Q62172
Predicted Effect probably benign
Transcript: ENSMUST00000024905
AA Change: V467I

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000024905
Gene: ENSMUSG00000024096
AA Change: V467I

DomainStartEndE-ValueType
low complexity region 63 80 N/A INTRINSIC
low complexity region 112 152 N/A INTRINSIC
low complexity region 159 180 N/A INTRINSIC
RhoGAP 207 373 1.04e-60 SMART
Blast:RhoGAP 391 493 1e-48 BLAST
low complexity region 533 551 N/A INTRINSIC
low complexity region 587 598 N/A INTRINSIC
low complexity region 602 621 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166543
AA Change: V467I

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000129448
Gene: ENSMUSG00000024096
AA Change: V467I

DomainStartEndE-ValueType
low complexity region 63 80 N/A INTRINSIC
low complexity region 112 152 N/A INTRINSIC
low complexity region 159 180 N/A INTRINSIC
RhoGAP 207 373 1.04e-60 SMART
Blast:RhoGAP 391 493 1e-48 BLAST
low complexity region 533 551 N/A INTRINSIC
low complexity region 587 598 N/A INTRINSIC
low complexity region 602 621 N/A INTRINSIC
Meta Mutation Damage Score 0.1301 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] RALBP1 plays a role in receptor-mediated endocytosis and is a downstream effector of the small GTP-binding protein RAL (see RALA; MIM 179550). Small G proteins, such as RAL, have GDP-bound inactive and GTP-bound active forms, which shift from the inactive to the active state through the action of RALGDS (MIM 601619), which in turn is activated by RAS (see HRAS; MIM 190020) (summary by Feig, 2003 [PubMed 12888294]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Homozygous and heterozygous null mice display increased sensitivity to X-ray irradiation, increased oxidative stress, and impaired glutathione homeostasis. Mice homozygous for a gene trap insertion exhibit decreases in exploratory and locomotor activity and a decreased sensitivity to pain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T G 11: 84,151,505 (GRCm39) V801G possibly damaging Het
Actbl2 T A 13: 111,392,127 (GRCm39) M154K probably benign Het
Adam7 A T 14: 68,741,915 (GRCm39) probably null Het
Arfgef1 T A 1: 10,251,122 (GRCm39) T888S probably benign Het
AW554918 C T 18: 25,302,117 (GRCm39) P10L possibly damaging Het
Bcap29 A G 12: 31,680,881 (GRCm39) I35T probably damaging Het
Bhlhe40 TG TGG 6: 108,641,818 (GRCm39) 254 probably null Het
Cby2 A G 14: 75,830,077 (GRCm39) S39P probably benign Het
Cdc25b A G 2: 131,036,574 (GRCm39) D458G probably damaging Het
Cdc42bpb T C 12: 111,272,101 (GRCm39) K1104R probably benign Het
Cep89 A G 7: 35,137,803 (GRCm39) N729S probably damaging Het
Clec4a4 T A 6: 122,968,788 (GRCm39) M51K possibly damaging Het
Dcdc2b A G 4: 129,503,422 (GRCm39) L270P probably damaging Het
Dennd5b G T 6: 148,937,981 (GRCm39) H639N probably damaging Het
Dnah11 T G 12: 117,991,212 (GRCm39) T2385P probably benign Het
Dnah11 T C 12: 118,089,520 (GRCm39) E1182G probably damaging Het
Dok7 T C 5: 35,223,815 (GRCm39) V81A probably damaging Het
Dtx1 T A 5: 120,820,458 (GRCm39) M494L possibly damaging Het
Foxj1 A T 11: 116,223,080 (GRCm39) L241Q possibly damaging Het
Gbp10 G A 5: 105,384,015 (GRCm39) probably benign Het
Hnmt T A 2: 23,893,892 (GRCm39) T201S probably benign Het
Jup G T 11: 100,269,177 (GRCm39) T412K possibly damaging Het
Kcnh2 G A 5: 24,527,057 (GRCm39) S954F probably damaging Het
Klhdc7b A C 15: 89,272,847 (GRCm39) K585T possibly damaging Het
Klk7 T A 7: 43,461,424 (GRCm39) S14T probably benign Het
Lama4 G A 10: 38,923,944 (GRCm39) E451K probably damaging Het
Ldhb A G 6: 142,441,399 (GRCm39) C164R probably damaging Het
Malrd1 G A 2: 15,614,901 (GRCm39) D239N Het
Mgam T A 6: 40,643,788 (GRCm39) V572E probably damaging Het
Mrgprb2 G T 7: 48,201,890 (GRCm39) N278K probably damaging Het
Msto1 A G 3: 88,819,130 (GRCm39) Y206H probably damaging Het
Myo6 A G 9: 80,169,573 (GRCm39) S467G unknown Het
Mysm1 T A 4: 94,849,964 (GRCm39) I447L probably benign Het
Nav3 T C 10: 109,688,795 (GRCm39) E494G possibly damaging Het
Nol10 T G 12: 17,452,174 (GRCm39) V376G probably damaging Het
Nup205 T A 6: 35,191,611 (GRCm39) I1032N probably damaging Het
Oog2 A G 4: 143,921,851 (GRCm39) K254E probably benign Het
Or10ac1 A G 6: 42,515,662 (GRCm39) F98S possibly damaging Het
Or52z12 A T 7: 103,233,588 (GRCm39) I120L possibly damaging Het
Or5b98 A G 19: 12,931,811 (GRCm39) N286S probably damaging Het
Or5d41 A T 2: 88,055,366 (GRCm39) Y3* probably null Het
Or5g25 T A 2: 85,477,768 (GRCm39) D299V possibly damaging Het
Or5g27 A G 2: 85,409,640 (GRCm39) D19G probably benign Het
Or6b1 T G 6: 42,815,680 (GRCm39) Y288* probably null Het
Or6c6 A T 10: 129,186,426 (GRCm39) probably benign Het
Or8h10 G A 2: 86,808,501 (GRCm39) T213I probably benign Het
Osbpl11 T A 16: 33,056,649 (GRCm39) D694E probably benign Het
Pcm1 T A 8: 41,746,547 (GRCm39) Y1210N probably benign Het
Pdxk T C 10: 78,276,697 (GRCm39) M293V probably benign Het
Plcb3 T C 19: 6,940,235 (GRCm39) I451V probably benign Het
Plekhm2 A G 4: 141,361,687 (GRCm39) F272S probably damaging Het
Pramel32 C A 4: 88,546,202 (GRCm39) R380L probably benign Het
Ptgdr A T 14: 45,095,689 (GRCm39) probably null Het
Ptprf C T 4: 118,083,720 (GRCm39) V788I probably benign Het
Ralgds A C 2: 28,433,667 (GRCm39) Q229P possibly damaging Het
Recql T C 6: 142,320,610 (GRCm39) D146G probably damaging Het
Reln T C 5: 22,256,365 (GRCm39) N493S probably damaging Het
Rfxank C T 8: 70,587,936 (GRCm39) probably null Het
Scn5a A T 9: 119,315,596 (GRCm39) M1704K probably damaging Het
Slc7a7 G T 14: 54,611,725 (GRCm39) A316E possibly damaging Het
Slco1a6 A T 6: 142,036,794 (GRCm39) C538S probably benign Het
Stard6 T C 18: 70,631,718 (GRCm39) probably null Het
Strip2 T A 6: 29,927,612 (GRCm39) M219K possibly damaging Het
Tcam1 T C 11: 106,174,911 (GRCm39) V122A probably damaging Het
Tha1 A G 11: 117,760,516 (GRCm39) V236A possibly damaging Het
Tmem201 A T 4: 149,815,554 (GRCm39) I132N possibly damaging Het
Tnc T C 4: 63,938,894 (GRCm39) probably benign Het
Vmn1r42 T C 6: 89,822,495 (GRCm39) T25A probably benign Het
Vmn2r94 T A 17: 18,464,765 (GRCm39) probably null Het
Wdfy4 A C 14: 32,790,863 (GRCm39) V2188G Het
Zfp623 T C 15: 75,819,247 (GRCm39) S68P probably damaging Het
Zfp950 A T 19: 61,107,593 (GRCm39) C497S probably damaging Het
Zkscan2 C T 7: 123,079,327 (GRCm39) E877K probably damaging Het
Zp3r C A 1: 130,504,790 (GRCm39) V536L probably damaging Het
Other mutations in Ralbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00671:Ralbp1 APN 17 66,171,607 (GRCm39) missense possibly damaging 0.87
IGL00736:Ralbp1 APN 17 66,171,718 (GRCm39) missense probably damaging 1.00
IGL01318:Ralbp1 APN 17 66,171,277 (GRCm39) missense probably damaging 1.00
IGL01661:Ralbp1 APN 17 66,168,384 (GRCm39) missense probably damaging 0.99
IGL02523:Ralbp1 APN 17 66,166,086 (GRCm39) missense probably damaging 0.99
R0507:Ralbp1 UTSW 17 66,156,955 (GRCm39) missense probably benign 0.08
R0666:Ralbp1 UTSW 17 66,161,124 (GRCm39) missense probably benign 0.28
R0674:Ralbp1 UTSW 17 66,159,748 (GRCm39) missense probably benign 0.28
R1418:Ralbp1 UTSW 17 66,166,143 (GRCm39) splice site probably benign
R2136:Ralbp1 UTSW 17 66,171,661 (GRCm39) missense probably damaging 1.00
R2320:Ralbp1 UTSW 17 66,159,742 (GRCm39) missense possibly damaging 0.71
R4657:Ralbp1 UTSW 17 66,159,686 (GRCm39) missense probably null 0.99
R5482:Ralbp1 UTSW 17 66,168,563 (GRCm39) nonsense probably null
R5545:Ralbp1 UTSW 17 66,157,099 (GRCm39) missense possibly damaging 0.77
R5967:Ralbp1 UTSW 17 66,171,274 (GRCm39) missense probably benign 0.19
R6512:Ralbp1 UTSW 17 66,168,270 (GRCm39) missense probably damaging 1.00
R6853:Ralbp1 UTSW 17 66,159,751 (GRCm39) missense possibly damaging 0.86
R7423:Ralbp1 UTSW 17 66,165,976 (GRCm39) missense probably damaging 0.99
R7545:Ralbp1 UTSW 17 66,174,593 (GRCm39) missense probably benign
R8394:Ralbp1 UTSW 17 66,159,748 (GRCm39) missense probably benign 0.28
R8755:Ralbp1 UTSW 17 66,166,036 (GRCm39) missense possibly damaging 0.91
R9425:Ralbp1 UTSW 17 66,171,506 (GRCm39) missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- AGAAGGCAGCTTCTTTCTCC -3'
(R):5'- CGGTCATCATTACAGACAGTTCC -3'

Sequencing Primer
(F):5'- CACACACAGCACAAGGGTAGG -3'
(R):5'- AGTTCCCTACTGCTGCTGGG -3'
Posted On 2019-09-13