Incidental Mutation 'R0625:Phc2'
ID57407
Institutional Source Beutler Lab
Gene Symbol Phc2
Ensembl Gene ENSMUSG00000028796
Gene Namepolyhomeotic 2
SynonymsEdr2, D4Ertd810e, Mph2, D130050K19Rik
MMRRC Submission 038814-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0625 (G1)
Quality Score192
Status Not validated
Chromosome4
Chromosomal Location128654702-128752881 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 128723710 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Aspartic acid at position 510 (H510D)
Ref Sequence ENSEMBL: ENSMUSP00000101690 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030588] [ENSMUST00000106079] [ENSMUST00000106080] [ENSMUST00000120946] [ENSMUST00000133439] [ENSMUST00000134421] [ENSMUST00000138445] [ENSMUST00000143632] [ENSMUST00000147572]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030588
AA Change: H510D

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000030588
Gene: ENSMUSG00000028796
AA Change: H510D

DomainStartEndE-ValueType
low complexity region 15 41 N/A INTRINSIC
low complexity region 74 119 N/A INTRINSIC
low complexity region 126 152 N/A INTRINSIC
low complexity region 232 248 N/A INTRINSIC
low complexity region 257 269 N/A INTRINSIC
low complexity region 343 367 N/A INTRINSIC
low complexity region 487 499 N/A INTRINSIC
low complexity region 529 543 N/A INTRINSIC
Pfam:PHC2_SAM_assoc 662 781 2.6e-55 PFAM
SAM 783 850 8.53e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106079
SMART Domains Protein: ENSMUSP00000101689
Gene: ENSMUSG00000028796

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
PDB:2L8E|A 105 135 1e-6 PDB
low complexity region 216 228 N/A INTRINSIC
SAM 256 323 8.53e-12 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000106080
AA Change: H510D

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000101690
Gene: ENSMUSG00000028796
AA Change: H510D

DomainStartEndE-ValueType
low complexity region 15 41 N/A INTRINSIC
low complexity region 74 119 N/A INTRINSIC
low complexity region 126 152 N/A INTRINSIC
low complexity region 232 248 N/A INTRINSIC
low complexity region 257 269 N/A INTRINSIC
low complexity region 343 367 N/A INTRINSIC
low complexity region 487 499 N/A INTRINSIC
low complexity region 529 543 N/A INTRINSIC
PDB:2L8E|A 632 662 4e-7 PDB
low complexity region 743 755 N/A INTRINSIC
SAM 783 850 8.53e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120946
Predicted Effect probably benign
Transcript: ENSMUST00000133439
SMART Domains Protein: ENSMUSP00000117163
Gene: ENSMUSG00000028796

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134421
SMART Domains Protein: ENSMUSP00000123307
Gene: ENSMUSG00000028796

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
PDB:2L8E|A 105 135 6e-7 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000138445
Predicted Effect probably benign
Transcript: ENSMUST00000143632
Predicted Effect probably benign
Transcript: ENSMUST00000147572
SMART Domains Protein: ENSMUSP00000118298
Gene: ENSMUSG00000028796

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
PDB:2L8E|A 105 135 8e-7 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155653
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In Drosophila melanogaster, the 'Polycomb' group (PcG) of genes are part of a cellular memory system that is responsible for the stable inheritance of gene activity. PcG proteins form a large multimeric, chromatin-associated protein complex. The protein encoded by this gene has homology to the Drosophila PcG protein 'polyhomeotic' (Ph) and is known to heterodimerize with EDR1 and colocalize with BMI1 in interphase nuclei of human cells. The specific function in human cells has not yet been determined. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele have normal skulls but exhibit posterior homeotic transformations of the axial skeleton. Cultured mouse embryonic fibroblasts show defects in proliferation and premature senescence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930550C14Rik T C 9: 53,408,065 S2P probably benign Het
Abca16 A C 7: 120,435,893 T301P probably damaging Het
Acer2 A G 4: 86,887,162 D121G possibly damaging Het
Adgrd1 T C 5: 129,171,931 probably null Het
Arhgap11a T C 2: 113,841,711 I249V probably benign Het
Arhgap22 A G 14: 33,366,714 E219G probably benign Het
C2cd4b T A 9: 67,759,751 S10T probably benign Het
Cnot6 A T 11: 49,683,171 I224N probably damaging Het
Ctrc T C 4: 141,841,518 T125A probably damaging Het
Cxxc5 T G 18: 35,858,589 S14R unknown Het
Cyp4f37 T G 17: 32,634,678 F445L probably damaging Het
Dcbld1 T G 10: 52,312,850 I186S probably benign Het
Dmxl2 T C 9: 54,382,702 T2510A probably benign Het
Dnah3 A G 7: 120,071,887 I591T possibly damaging Het
Dock5 A T 14: 67,841,163 I204N probably benign Het
Dysf G A 6: 84,111,987 probably null Het
Erich5 A G 15: 34,471,369 E248G probably damaging Het
Fam160a1 A G 3: 85,730,500 V164A possibly damaging Het
Foxm1 A G 6: 128,373,871 S712G probably damaging Het
Frmpd1 A G 4: 45,284,055 T959A probably benign Het
Gfra4 C T 2: 131,040,256 V277I probably null Het
Hacd4 T C 4: 88,435,010 I82V probably benign Het
Itih2 C T 2: 10,123,414 V159I possibly damaging Het
Itpr2 T A 6: 146,166,651 M2410L probably benign Het
March11 A G 15: 26,311,043 I202V probably damaging Het
March3 A G 18: 56,811,830 probably null Het
Med12l G A 3: 59,247,437 E1135K probably damaging Het
Mib2 C T 4: 155,659,460 G42S probably damaging Het
Mlx T C 11: 101,087,782 L78P possibly damaging Het
Muc5b T C 7: 141,846,427 C473R unknown Het
N4bp2l1 T A 5: 150,576,745 R66* probably null Het
Nes A G 3: 87,977,172 T913A possibly damaging Het
Oas1a T C 5: 120,899,259 E235G probably damaging Het
Olfr1104 T A 2: 87,021,620 H308L probably benign Het
Olfr477 T C 7: 107,991,189 S275P probably damaging Het
Olfr905 T C 9: 38,473,208 S154P possibly damaging Het
Parn C T 16: 13,640,294 V286I probably benign Het
Paxip1 G A 5: 27,765,942 Q470* probably null Het
Pla2g4f T A 2: 120,305,041 D384V probably damaging Het
Plpbp A T 8: 27,045,131 N68I probably damaging Het
Podxl2 G A 6: 88,849,955 A123V possibly damaging Het
Pole A T 5: 110,325,550 T1737S possibly damaging Het
Ppp3cc T C 14: 70,225,027 E396G probably damaging Het
Pramel7 T A 2: 87,491,008 I228F probably benign Het
Prl7d1 A T 13: 27,710,140 C149S probably benign Het
Qtrt1 G T 9: 21,418,288 M217I probably benign Het
Sec24a T A 11: 51,729,454 D456V probably damaging Het
Shox2 T G 3: 66,981,544 probably null Het
Skint2 T A 4: 112,624,086 S49T probably damaging Het
Smarca5 A G 8: 80,720,686 probably null Het
Sorcs2 T A 5: 36,024,572 D1068V possibly damaging Het
Tmem114 T C 16: 8,412,102 probably null Het
Ttc7b T A 12: 100,355,046 M24L probably benign Het
Ttll3 A G 6: 113,408,903 probably null Het
Usp7 C T 16: 8,704,982 D102N probably benign Het
Other mutations in Phc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00727:Phc2 APN 4 128745844 missense probably damaging 1.00
IGL01470:Phc2 APN 4 128723110 missense probably benign 0.00
IGL02171:Phc2 APN 4 128711065 missense probably damaging 1.00
IGL02884:Phc2 APN 4 128708016 missense probably damaging 1.00
I1329:Phc2 UTSW 4 128711113 missense probably damaging 0.98
PIT4696001:Phc2 UTSW 4 128705202 missense probably damaging 1.00
R0483:Phc2 UTSW 4 128723307 unclassified probably benign
R1392:Phc2 UTSW 4 128745087 missense possibly damaging 0.63
R1392:Phc2 UTSW 4 128745087 missense possibly damaging 0.63
R1429:Phc2 UTSW 4 128743555 missense probably damaging 1.00
R1701:Phc2 UTSW 4 128751607 missense probably damaging 1.00
R1820:Phc2 UTSW 4 128743543 missense probably damaging 0.99
R2011:Phc2 UTSW 4 128723585 missense probably benign 0.27
R2063:Phc2 UTSW 4 128747136 missense probably damaging 1.00
R2064:Phc2 UTSW 4 128747136 missense probably damaging 1.00
R2065:Phc2 UTSW 4 128747136 missense probably damaging 1.00
R2066:Phc2 UTSW 4 128747136 missense probably damaging 1.00
R2067:Phc2 UTSW 4 128747136 missense probably damaging 1.00
R2152:Phc2 UTSW 4 128745066 makesense probably null
R2375:Phc2 UTSW 4 128723025 missense probably benign
R2430:Phc2 UTSW 4 128707983 missense probably damaging 1.00
R3910:Phc2 UTSW 4 128743558 critical splice donor site probably null
R3911:Phc2 UTSW 4 128743558 critical splice donor site probably null
R3941:Phc2 UTSW 4 128747244 critical splice donor site probably null
R4108:Phc2 UTSW 4 128707983 missense probably damaging 1.00
R4585:Phc2 UTSW 4 128743510 missense probably damaging 1.00
R4731:Phc2 UTSW 4 128707971 missense probably damaging 1.00
R4801:Phc2 UTSW 4 128751598 missense probably damaging 1.00
R4802:Phc2 UTSW 4 128751598 missense probably damaging 1.00
R4948:Phc2 UTSW 4 128723115 missense probably benign 0.00
R5498:Phc2 UTSW 4 128708994 missense probably benign 0.37
R5712:Phc2 UTSW 4 128745095 missense probably damaging 1.00
R5742:Phc2 UTSW 4 128745868 missense probably damaging 1.00
R6272:Phc2 UTSW 4 128709647 missense probably damaging 1.00
R6298:Phc2 UTSW 4 128748189 missense possibly damaging 0.91
R6348:Phc2 UTSW 4 128705151 missense probably benign 0.00
R6630:Phc2 UTSW 4 128723630 missense probably damaging 0.97
R6925:Phc2 UTSW 4 128748134 missense probably damaging 1.00
R7067:Phc2 UTSW 4 128747141 missense probably benign 0.02
R7396:Phc2 UTSW 4 128748161 missense probably benign 0.21
X0012:Phc2 UTSW 4 128709052 missense probably damaging 0.99
X0017:Phc2 UTSW 4 128723272 missense probably damaging 0.99
X0023:Phc2 UTSW 4 128708043 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- GAATCTTTGCATCTTTGCCCGAGC -3'
(R):5'- ACTGGTCACTCAGAGAGACAGATGG -3'

Sequencing Primer
(F):5'- CCAGGGTAGTGTCCGAGAAC -3'
(R):5'- CTCAGAGATGCTTCTGGCAAG -3'
Posted On2013-07-11