Mutagenetix > Incidental Mutation

Incidental Mutation 'R7400:Nfs1'

574080

Institutional Source

Beutler Lab

Gene Symbol

Nfs1

Ensembl Gene

ENSMUSG00000027618

Gene Name

nitrogen fixation gene 1 (S. cerevisiae)

Synonyms

m-Nfs1

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.971) question?

Stock #

R7400 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

156123639-156144186 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 156126323 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 408 (I408F)

Ref Sequence

ENSEMBL: ENSMUSP00000029147 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029147] [ENSMUST00000184469]

AlphaFold

Q9Z1J3

Predicted Effect

probably damaging
Transcript: ENSMUST00000029147
AA Change: I408F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000029147
Gene: ENSMUSG00000027618
AA Change: I408F

Domain	Start	End	E-Value	Type
low complexity region	10	31	N/A	INTRINSIC
Pfam:Aminotran_5	61	424	6.2e-94	PFAM
Pfam:Beta_elim_lyase	94	344	7.8e-12	PFAM
Pfam:DegT_DnrJ_EryC1	100	250	1.8e-6	PFAM

Predicted Effect

SMART Domains

Protein: ENSMUSP00000124101
Gene: ENSMUSG00000098950
AA Change: I54F

Domain	Start	End	E-Value	Type
SCOP:d1eg5a_	3	82	2e-15	SMART
PDB:1P3W\|A	3	86	3e-34	PDB
low complexity region	93	106	N/A	INTRINSIC
Blast:RRM_2	124	160	2e-14	BLAST

Predicted Effect

SMART Domains

Protein: ENSMUSP00000124858
Gene: ENSMUSG00000098950
AA Change: Y31F

Domain	Start	End	E-Value	Type
PDB:1P3W\|A	3	28	1e-6	PDB
low complexity region	36	50	N/A	INTRINSIC

Predicted Effect

SMART Domains

Protein: ENSMUSP00000125190
Gene: ENSMUSG00000098950
AA Change: I54F

Domain	Start	End	E-Value	Type
SCOP:d1eg5a_	3	82	1e-15	SMART
PDB:1P3W\|A	3	86	2e-34	PDB
low complexity region	93	106	N/A	INTRINSIC
Blast:RRM_2	124	161	1e-14	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000184469

SMART Domains

Protein: ENSMUSP00000139294
Gene: ENSMUSG00000027618

Domain	Start	End	E-Value	Type
Pfam:Aminotran_5	1	81	2.3e-10	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

97% (69/71)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Iron-sulfur clusters are required for the function of many cellular enzymes. The proteins encoded by this gene supply inorganic sulfur to these clusters by removing the sulfur from cysteine, creating alanine in the process. This gene uses alternate in-frame translation initiation sites to generate mitochondrial forms and cytoplasmic/nuclear forms. Selection of the alternative initiation sites is determined by the cytosolic pH. The encoded proteins belong to the class-V family of pyridoxal phosphate-dependent aminotransferases. Alternatively spliced transcript variants have been described. [provided by RefSeq, Nov 2010]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1300017J02Rik	T	A	9: 103,250,662	E690V	probably benign	Het
4932414N04Rik	T	C	2: 68,666,203	S118P	unknown	Het
Ahnak	T	A	19: 9,014,613	D4420E	probably damaging	Het
Atp5g2	C	T	15: 102,665,112	A90T	possibly damaging	Het
Batf2	A	G	19: 6,171,508	Y116C	probably damaging	Het
Cd48	G	A	1: 171,695,925	R112H	probably benign	Het
Cdh8	A	T	8: 99,279,560	Y132N	probably damaging	Het
Cfap70	A	C	14: 20,408,267	S793A	probably benign	Het
Cmip	A	G	8: 117,257,405		probably null	Het
Cyp1a2	T	C	9: 57,681,940	N197S	probably benign	Het
Diaph1	T	C	18: 37,854,502	D1067G	probably damaging	Het
Disp2	T	C	2: 118,791,886	L1033P	probably damaging	Het
Dock6	G	T	9: 21,801,807	A1981D	possibly damaging	Het
Eci3	T	C	13: 34,959,977	D55G	probably benign	Het
Eea1	T	A	10: 95,995,570	D174E	probably benign	Het
Ehd2	T	C	7: 15,950,656	E406G	possibly damaging	Het
Erich3	A	G	3: 154,762,577	K889E		Het
Fat4	C	A	3: 38,887,924	T322K	probably damaging	Het
Fitm1	A	T	14: 55,576,769	I241F	possibly damaging	Het
Fscb	C	A	12: 64,471,617	S1025I	unknown	Het
Gm4070	T	A	7: 105,902,040	I602F	probably benign	Het
Gpsm2	T	A	3: 108,679,688	D644V	probably damaging	Het
Gucy2d	C	A	7: 98,443,640	L75M	possibly damaging	Het
Hmcn1	T	C	1: 150,674,430	I2668V	probably damaging	Het
Hoxa7	A	G	6: 52,217,053	I118T	possibly damaging	Het
Hsp90ab1	A	G	17: 45,569,284	V473A	probably benign	Het
Ica1l	T	C	1: 60,042,642		probably null	Het
Ighv1-72	A	G	12: 115,758,217	S40P	probably damaging	Het
Kif28	A	C	1: 179,700,274	W771G	probably damaging	Het
Klf13	G	C	7: 63,938,248	A100G	probably benign	Het
Klhl5	A	G	5: 65,148,590	E300G	possibly damaging	Het
Krt40	A	G	11: 99,543,143	S6P	probably benign	Het
Map3k13	C	T	16: 21,922,322	R800W	probably damaging	Het
Mef2d	T	C	3: 88,167,731	L408P	possibly damaging	Het
Mmp10	T	A	9: 7,503,300	M87K	probably damaging	Het
Mrgprd	T	A	7: 145,321,906	H171Q	probably benign	Het
Muc1	C	T	3: 89,230,646	T265I	possibly damaging	Het
Myo15b	A	G	11: 115,860,113	N570D		Het
Npdc1	G	T	2: 25,406,245	C48F	probably damaging	Het
Olfr137	A	T	17: 38,305,331	N43K	possibly damaging	Het
Olfr459	A	T	6: 41,771,744	L185H	probably damaging	Het
Olfr592	T	C	7: 103,187,380	S260P	probably damaging	Het
Olfr676	T	C	7: 105,035,210	I4T	probably benign	Het
Osbpl2	T	C	2: 180,153,321	M332T	probably benign	Het
Ostm1	T	A	10: 42,698,217	V302D	probably damaging	Het
Otof	T	C	5: 30,385,188	D672G	probably benign	Het
Plekha6	A	T	1: 133,274,024	K392*	probably null	Het
Pnpla1	A	T	17: 28,858,976	D37V	probably damaging	Het
Rasgrp1	A	G	2: 117,298,545	S198P	probably damaging	Het
Reln	A	T	5: 21,971,934	N1911K	probably damaging	Het
Ripply3	C	A	16: 94,335,900	A140E	probably benign	Het
Siglec1	A	G	2: 131,086,095	C8R	possibly damaging	Het
Slamf6	T	C	1: 171,919,793	S41P	unknown	Het
Slc15a5	A	G	6: 138,073,057	M120T	probably benign	Het
Slc25a20	T	G	9: 108,681,973	D179E	possibly damaging	Het
Sltm	T	A	9: 70,586,070	V783E	probably damaging	Het
Smc1b	C	A	15: 85,069,720	R1116L	probably damaging	Het
Smim23	A	G	11: 32,824,471	V16A	probably benign	Het
Spata20	A	G	11: 94,483,400	V348A	probably benign	Het
Spen	T	C	4: 141,473,741	D2525G	probably damaging	Het
St14	A	C	9: 31,108,275	N83K	probably benign	Het
Stab1	T	C	14: 31,157,384	N713S	probably null	Het
Syne1	A	T	10: 5,218,580	L5267H	probably benign	Het
Tenm4	T	C	7: 96,694,803	L271P	probably damaging	Het
Tfap2d	C	T	1: 19,142,926	H325Y	possibly damaging	Het
Trav23	A	G	14: 53,977,563	R78G	probably benign	Het
Ttc39c	A	T	18: 12,643,799		probably benign	Het
Unc79	A	G	12: 103,104,630	D1228G	probably damaging	Het
Vmn1r66	T	A	7: 10,274,947	H53L	probably damaging	Het
Vps13b	A	T	15: 35,378,900	L53F	probably damaging	Het
Zfp532	C	T	18: 65,638,913	T834M	possibly damaging	Het

Other mutations in Nfs1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02318:Nfs1	APN	2	156124271	missense	probably damaging	1.00
IGL02944:Nfs1	APN	2	156127768	missense	probably damaging	1.00
IGL03350:Nfs1	APN	2	156127740	missense	probably benign	0.37
lantana	UTSW	2	156134449	missense	possibly damaging	0.94
G1Funyon:Nfs1	UTSW	2	156134493	nonsense	probably null
R0118:Nfs1	UTSW	2	156134524	missense	probably damaging	1.00
R0374:Nfs1	UTSW	2	156132660	missense	probably damaging	1.00
R1653:Nfs1	UTSW	2	156125336	missense	probably damaging	1.00
R3787:Nfs1	UTSW	2	156128583	missense	possibly damaging	0.53
R4614:Nfs1	UTSW	2	156144050	missense	probably benign	0.04
R4782:Nfs1	UTSW	2	156134449	missense	possibly damaging	0.94
R4799:Nfs1	UTSW	2	156134449	missense	possibly damaging	0.94
R5053:Nfs1	UTSW	2	156126398	missense	probably damaging	0.99
R5447:Nfs1	UTSW	2	156142136	missense	probably benign	0.01
R5479:Nfs1	UTSW	2	156128502	missense	probably damaging	1.00
R5992:Nfs1	UTSW	2	156134453	missense	probably damaging	0.98
R7267:Nfs1	UTSW	2	156123783	missense	probably benign	0.12
R7886:Nfs1	UTSW	2	156142061	missense	unknown
R8301:Nfs1	UTSW	2	156134493	nonsense	probably null
R8729:Nfs1	UTSW	2	156123807	missense	probably benign	0.20
R8905:Nfs1	UTSW	2	156128583	missense	probably damaging	0.96
R9099:Nfs1	UTSW	2	156127014	missense	probably damaging	1.00
R9417:Nfs1	UTSW	2	156123931	nonsense	probably null
R9661:Nfs1	UTSW	2	156128553	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- GCTGAATACAGGACTCAGACAC -3'
(R):5'- TACATCCCAGGCTGTACAGG -3'

Sequencing Primer
(F):5'- CAGGAAGAGTGCTTGCCTATC -3'
(R):5'- AGGGCATCACCAGGCTGTTTC -3'

Posted On

2019-09-13