Incidental Mutation 'R7400:Nfs1'
ID 574080
Institutional Source Beutler Lab
Gene Symbol Nfs1
Ensembl Gene ENSMUSG00000027618
Gene Name nitrogen fixation gene 1 (S. cerevisiae)
Synonyms m-Nfs1
MMRRC Submission 045482-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.969) question?
Stock # R7400 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 155965559-155986106 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 155968243 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 408 (I408F)
Ref Sequence ENSEMBL: ENSMUSP00000029147 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029147] [ENSMUST00000184469]
AlphaFold Q9Z1J3
Predicted Effect probably damaging
Transcript: ENSMUST00000029147
AA Change: I408F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000029147
Gene: ENSMUSG00000027618
AA Change: I408F

DomainStartEndE-ValueType
low complexity region 10 31 N/A INTRINSIC
Pfam:Aminotran_5 61 424 6.2e-94 PFAM
Pfam:Beta_elim_lyase 94 344 7.8e-12 PFAM
Pfam:DegT_DnrJ_EryC1 100 250 1.8e-6 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000124101
Gene: ENSMUSG00000098950
AA Change: I54F

DomainStartEndE-ValueType
SCOP:d1eg5a_ 3 82 2e-15 SMART
PDB:1P3W|A 3 86 3e-34 PDB
low complexity region 93 106 N/A INTRINSIC
Blast:RRM_2 124 160 2e-14 BLAST
Predicted Effect
SMART Domains Protein: ENSMUSP00000124858
Gene: ENSMUSG00000098950
AA Change: Y31F

DomainStartEndE-ValueType
PDB:1P3W|A 3 28 1e-6 PDB
low complexity region 36 50 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000125190
Gene: ENSMUSG00000098950
AA Change: I54F

DomainStartEndE-ValueType
SCOP:d1eg5a_ 3 82 1e-15 SMART
PDB:1P3W|A 3 86 2e-34 PDB
low complexity region 93 106 N/A INTRINSIC
Blast:RRM_2 124 161 1e-14 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000184469
SMART Domains Protein: ENSMUSP00000139294
Gene: ENSMUSG00000027618

DomainStartEndE-ValueType
Pfam:Aminotran_5 1 81 2.3e-10 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 97% (69/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Iron-sulfur clusters are required for the function of many cellular enzymes. The proteins encoded by this gene supply inorganic sulfur to these clusters by removing the sulfur from cysteine, creating alanine in the process. This gene uses alternate in-frame translation initiation sites to generate mitochondrial forms and cytoplasmic/nuclear forms. Selection of the alternative initiation sites is determined by the cytosolic pH. The encoded proteins belong to the class-V family of pyridoxal phosphate-dependent aminotransferases. Alternatively spliced transcript variants have been described. [provided by RefSeq, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik T C 2: 68,496,547 (GRCm39) S118P unknown Het
Ahnak T A 19: 8,991,977 (GRCm39) D4420E probably damaging Het
Atp5mc2 C T 15: 102,573,547 (GRCm39) A90T possibly damaging Het
Batf2 A G 19: 6,221,538 (GRCm39) Y116C probably damaging Het
Cd48 G A 1: 171,523,493 (GRCm39) R112H probably benign Het
Cdh8 A T 8: 100,006,192 (GRCm39) Y132N probably damaging Het
Cfap70 A C 14: 20,458,335 (GRCm39) S793A probably benign Het
Cmip A G 8: 117,984,144 (GRCm39) probably null Het
Cyp1a2 T C 9: 57,589,223 (GRCm39) N197S probably benign Het
Diaph1 T C 18: 37,987,555 (GRCm39) D1067G probably damaging Het
Disp2 T C 2: 118,622,367 (GRCm39) L1033P probably damaging Het
Dock6 G T 9: 21,713,103 (GRCm39) A1981D possibly damaging Het
Eci3 T C 13: 35,143,960 (GRCm39) D55G probably benign Het
Eea1 T A 10: 95,831,432 (GRCm39) D174E probably benign Het
Ehd2 T C 7: 15,684,581 (GRCm39) E406G possibly damaging Het
Erich3 A G 3: 154,468,214 (GRCm39) K889E Het
Fat4 C A 3: 38,942,073 (GRCm39) T322K probably damaging Het
Fitm1 A T 14: 55,814,226 (GRCm39) I241F possibly damaging Het
Fscb C A 12: 64,518,391 (GRCm39) S1025I unknown Het
Gpsm2 T A 3: 108,587,004 (GRCm39) D644V probably damaging Het
Gucy2d C A 7: 98,092,847 (GRCm39) L75M possibly damaging Het
Gvin2 T A 7: 105,551,247 (GRCm39) I602F probably benign Het
Hmcn1 T C 1: 150,550,181 (GRCm39) I2668V probably damaging Het
Hoxa7 A G 6: 52,194,033 (GRCm39) I118T possibly damaging Het
Hsp90ab1 A G 17: 45,880,210 (GRCm39) V473A probably benign Het
Ica1l T C 1: 60,081,801 (GRCm39) probably null Het
Ighv1-72 A G 12: 115,721,837 (GRCm39) S40P probably damaging Het
Inhca T A 9: 103,127,861 (GRCm39) E690V probably benign Het
Kif28 A C 1: 179,527,839 (GRCm39) W771G probably damaging Het
Klf13 G C 7: 63,587,996 (GRCm39) A100G probably benign Het
Klhl5 A G 5: 65,305,933 (GRCm39) E300G possibly damaging Het
Krt40 A G 11: 99,433,969 (GRCm39) S6P probably benign Het
Map3k13 C T 16: 21,741,072 (GRCm39) R800W probably damaging Het
Mef2d T C 3: 88,075,038 (GRCm39) L408P possibly damaging Het
Mmp10 T A 9: 7,503,301 (GRCm39) M87K probably damaging Het
Mrgprd T A 7: 144,875,643 (GRCm39) H171Q probably benign Het
Muc1 C T 3: 89,137,953 (GRCm39) T265I possibly damaging Het
Myo15b A G 11: 115,750,939 (GRCm39) N570D Het
Npdc1 G T 2: 25,296,257 (GRCm39) C48F probably damaging Het
Or2j3 A T 17: 38,616,222 (GRCm39) N43K possibly damaging Het
Or52e7 T C 7: 104,684,417 (GRCm39) I4T probably benign Het
Or52j3 T C 7: 102,836,587 (GRCm39) S260P probably damaging Het
Or9a2 A T 6: 41,748,678 (GRCm39) L185H probably damaging Het
Osbpl2 T C 2: 179,795,114 (GRCm39) M332T probably benign Het
Ostm1 T A 10: 42,574,213 (GRCm39) V302D probably damaging Het
Otof T C 5: 30,542,532 (GRCm39) D672G probably benign Het
Plekha6 A T 1: 133,201,762 (GRCm39) K392* probably null Het
Pnpla1 A T 17: 29,077,950 (GRCm39) D37V probably damaging Het
Rasgrp1 A G 2: 117,129,026 (GRCm39) S198P probably damaging Het
Reln A T 5: 22,176,932 (GRCm39) N1911K probably damaging Het
Ripply3 C A 16: 94,136,759 (GRCm39) A140E probably benign Het
Siglec1 A G 2: 130,928,015 (GRCm39) C8R possibly damaging Het
Slamf6 T C 1: 171,747,360 (GRCm39) S41P unknown Het
Slc15a5 A G 6: 138,050,055 (GRCm39) M120T probably benign Het
Slc25a20 T G 9: 108,559,172 (GRCm39) D179E possibly damaging Het
Sltm T A 9: 70,493,352 (GRCm39) V783E probably damaging Het
Smc1b C A 15: 84,953,921 (GRCm39) R1116L probably damaging Het
Smim23 A G 11: 32,774,471 (GRCm39) V16A probably benign Het
Spata20 A G 11: 94,374,226 (GRCm39) V348A probably benign Het
Spen T C 4: 141,201,052 (GRCm39) D2525G probably damaging Het
St14 A C 9: 31,019,571 (GRCm39) N83K probably benign Het
Stab1 T C 14: 30,879,341 (GRCm39) N713S probably null Het
Syne1 A T 10: 5,168,580 (GRCm39) L5267H probably benign Het
Tenm4 T C 7: 96,344,010 (GRCm39) L271P probably damaging Het
Tfap2d C T 1: 19,213,150 (GRCm39) H325Y possibly damaging Het
Trav23 A G 14: 54,215,020 (GRCm39) R78G probably benign Het
Ttc39c A T 18: 12,776,856 (GRCm39) probably benign Het
Unc79 A G 12: 103,070,889 (GRCm39) D1228G probably damaging Het
Vmn1r66 T A 7: 10,008,874 (GRCm39) H53L probably damaging Het
Vps13b A T 15: 35,379,046 (GRCm39) L53F probably damaging Het
Zfp532 C T 18: 65,771,984 (GRCm39) T834M possibly damaging Het
Other mutations in Nfs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02318:Nfs1 APN 2 155,966,191 (GRCm39) missense probably damaging 1.00
IGL02944:Nfs1 APN 2 155,969,688 (GRCm39) missense probably damaging 1.00
IGL03350:Nfs1 APN 2 155,969,660 (GRCm39) missense probably benign 0.37
lantana UTSW 2 155,976,369 (GRCm39) missense possibly damaging 0.94
G1Funyon:Nfs1 UTSW 2 155,976,413 (GRCm39) nonsense probably null
R0118:Nfs1 UTSW 2 155,976,444 (GRCm39) missense probably damaging 1.00
R0374:Nfs1 UTSW 2 155,974,580 (GRCm39) missense probably damaging 1.00
R1653:Nfs1 UTSW 2 155,967,256 (GRCm39) missense probably damaging 1.00
R3787:Nfs1 UTSW 2 155,970,503 (GRCm39) missense possibly damaging 0.53
R4614:Nfs1 UTSW 2 155,985,970 (GRCm39) missense probably benign 0.04
R4782:Nfs1 UTSW 2 155,976,369 (GRCm39) missense possibly damaging 0.94
R4799:Nfs1 UTSW 2 155,976,369 (GRCm39) missense possibly damaging 0.94
R5053:Nfs1 UTSW 2 155,968,318 (GRCm39) missense probably damaging 0.99
R5447:Nfs1 UTSW 2 155,984,056 (GRCm39) missense probably benign 0.01
R5479:Nfs1 UTSW 2 155,970,422 (GRCm39) missense probably damaging 1.00
R5992:Nfs1 UTSW 2 155,976,373 (GRCm39) missense probably damaging 0.98
R7267:Nfs1 UTSW 2 155,965,703 (GRCm39) missense probably benign 0.12
R7886:Nfs1 UTSW 2 155,983,981 (GRCm39) missense unknown
R8301:Nfs1 UTSW 2 155,976,413 (GRCm39) nonsense probably null
R8729:Nfs1 UTSW 2 155,965,727 (GRCm39) missense probably benign 0.20
R8905:Nfs1 UTSW 2 155,970,503 (GRCm39) missense probably damaging 0.96
R9099:Nfs1 UTSW 2 155,968,934 (GRCm39) missense probably damaging 1.00
R9417:Nfs1 UTSW 2 155,965,851 (GRCm39) nonsense probably null
R9661:Nfs1 UTSW 2 155,970,473 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GCTGAATACAGGACTCAGACAC -3'
(R):5'- TACATCCCAGGCTGTACAGG -3'

Sequencing Primer
(F):5'- CAGGAAGAGTGCTTGCCTATC -3'
(R):5'- AGGGCATCACCAGGCTGTTTC -3'
Posted On 2019-09-13