Incidental Mutation 'R7400:1300017J02Rik'
ID574109
Institutional Source Beutler Lab
Gene Symbol 1300017J02Rik
Ensembl Gene ENSMUSG00000033688
Gene NameRIKEN cDNA 1300017J02 gene
SynonymsmICA
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.429) question?
Stock #R7400 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location103250521-103305082 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 103250662 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 690 (E690V)
Ref Sequence ENSEMBL: ENSMUSP00000035163 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035163] [ENSMUST00000123530]
PDB Structure Crystal Structure of the Murine Inhibitor of Carbonic Anhydrase [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000035163
AA Change: E690V

PolyPhen 2 Score 0.253 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000035163
Gene: ENSMUSG00000033688
AA Change: E690V

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
TR_FER 25 352 5.48e-163 SMART
TR_FER 355 697 3.26e-179 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123530
AA Change: E612V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000115867
Gene: ENSMUSG00000033688
AA Change: E612V

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
TR_FER 25 351 3.67e-164 SMART
TR_FER 352 619 5.89e-104 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000154357
SMART Domains Protein: ENSMUSP00000123519
Gene: ENSMUSG00000033688

DomainStartEndE-ValueType
TR_FER 1 242 5.88e-81 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 97% (69/71)
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik T C 2: 68,666,203 S118P unknown Het
Ahnak T A 19: 9,014,613 D4420E probably damaging Het
Atp5g2 C T 15: 102,665,112 A90T possibly damaging Het
Batf2 A G 19: 6,171,508 Y116C probably damaging Het
Cd48 G A 1: 171,695,925 R112H probably benign Het
Cdh8 A T 8: 99,279,560 Y132N probably damaging Het
Cfap70 A C 14: 20,408,267 S793A probably benign Het
Cmip A G 8: 117,257,405 probably null Het
Cyp1a2 T C 9: 57,681,940 N197S probably benign Het
Diaph1 T C 18: 37,854,502 D1067G probably damaging Het
Disp2 T C 2: 118,791,886 L1033P probably damaging Het
Dock6 G T 9: 21,801,807 A1981D possibly damaging Het
Eci3 T C 13: 34,959,977 D55G probably benign Het
Eea1 T A 10: 95,995,570 D174E probably benign Het
Ehd2 T C 7: 15,950,656 E406G possibly damaging Het
Erich3 A G 3: 154,762,577 K889E Het
Fat4 C A 3: 38,887,924 T322K probably damaging Het
Fitm1 A T 14: 55,576,769 I241F possibly damaging Het
Fscb C A 12: 64,471,617 S1025I unknown Het
Gm4070 T A 7: 105,902,040 I602F probably benign Het
Gpsm2 T A 3: 108,679,688 D644V probably damaging Het
Gucy2d C A 7: 98,443,640 L75M possibly damaging Het
Hmcn1 T C 1: 150,674,430 I2668V probably damaging Het
Hoxa7 A G 6: 52,217,053 I118T possibly damaging Het
Hsp90ab1 A G 17: 45,569,284 V473A probably benign Het
Ica1l T C 1: 60,042,642 probably null Het
Ighv1-72 A G 12: 115,758,217 S40P probably damaging Het
Kif28 A C 1: 179,700,274 W771G probably damaging Het
Klf13 G C 7: 63,938,248 A100G probably benign Het
Klhl5 A G 5: 65,148,590 E300G possibly damaging Het
Krt40 A G 11: 99,543,143 S6P probably benign Het
Map3k13 C T 16: 21,922,322 R800W probably damaging Het
Mef2d T C 3: 88,167,731 L408P possibly damaging Het
Mmp10 T A 9: 7,503,300 M87K probably damaging Het
Mrgprd T A 7: 145,321,906 H171Q probably benign Het
Muc1 C T 3: 89,230,646 T265I possibly damaging Het
Myo15b A G 11: 115,860,113 N570D Het
Nfs1 T A 2: 156,126,323 I408F probably damaging Het
Npdc1 G T 2: 25,406,245 C48F probably damaging Het
Olfr137 A T 17: 38,305,331 N43K possibly damaging Het
Olfr459 A T 6: 41,771,744 L185H probably damaging Het
Olfr592 T C 7: 103,187,380 S260P probably damaging Het
Olfr676 T C 7: 105,035,210 I4T probably benign Het
Osbpl2 T C 2: 180,153,321 M332T probably benign Het
Ostm1 T A 10: 42,698,217 V302D probably damaging Het
Otof T C 5: 30,385,188 D672G probably benign Het
Plekha6 A T 1: 133,274,024 K392* probably null Het
Pnpla1 A T 17: 28,858,976 D37V probably damaging Het
Rasgrp1 A G 2: 117,298,545 S198P probably damaging Het
Reln A T 5: 21,971,934 N1911K probably damaging Het
Ripply3 C A 16: 94,335,900 A140E probably benign Het
Siglec1 A G 2: 131,086,095 C8R possibly damaging Het
Slamf6 T C 1: 171,919,793 S41P unknown Het
Slc15a5 A G 6: 138,073,057 M120T probably benign Het
Slc25a20 T G 9: 108,681,973 D179E possibly damaging Het
Sltm T A 9: 70,586,070 V783E probably damaging Het
Smc1b C A 15: 85,069,720 R1116L probably damaging Het
Smim23 A G 11: 32,824,471 V16A probably benign Het
Spata20 A G 11: 94,483,400 V348A probably benign Het
Spen T C 4: 141,473,741 D2525G probably damaging Het
St14 A C 9: 31,108,275 N83K probably benign Het
Stab1 T C 14: 31,157,384 N713S probably null Het
Syne1 A T 10: 5,218,580 L5267H probably benign Het
Tenm4 T C 7: 96,694,803 L271P probably damaging Het
Tfap2d C T 1: 19,142,926 H325Y possibly damaging Het
Trav23 A G 14: 53,977,563 R78G probably benign Het
Ttc39c A T 18: 12,643,799 probably benign Het
Unc79 A G 12: 103,104,630 D1228G probably damaging Het
Vmn1r66 T A 7: 10,274,947 H53L probably damaging Het
Vps13b A T 15: 35,378,900 L53F probably damaging Het
Zfp532 C T 18: 65,638,913 T834M possibly damaging Het
Other mutations in 1300017J02Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01371:1300017J02Rik APN 9 103254776 missense possibly damaging 0.48
IGL02370:1300017J02Rik APN 9 103263074 missense probably benign 0.27
IGL02899:1300017J02Rik APN 9 103277574 missense probably damaging 1.00
R0206:1300017J02Rik UTSW 9 103282662 missense probably damaging 1.00
R0206:1300017J02Rik UTSW 9 103282662 missense probably damaging 1.00
R0831:1300017J02Rik UTSW 9 103269779 missense possibly damaging 0.50
R0849:1300017J02Rik UTSW 9 103263057 missense possibly damaging 0.94
R1225:1300017J02Rik UTSW 9 103254839 splice site probably benign
R2061:1300017J02Rik UTSW 9 103268314 missense probably benign 0.01
R2176:1300017J02Rik UTSW 9 103259367 splice site probably benign
R4915:1300017J02Rik UTSW 9 103251855 nonsense probably null
R4917:1300017J02Rik UTSW 9 103251855 nonsense probably null
R5020:1300017J02Rik UTSW 9 103282502 missense probably benign 0.02
R5033:1300017J02Rik UTSW 9 103279414 missense probably benign 0.36
R5087:1300017J02Rik UTSW 9 103266221 missense probably damaging 0.98
R5174:1300017J02Rik UTSW 9 103282556 splice site probably null
R6283:1300017J02Rik UTSW 9 103282635 nonsense probably null
R7092:1300017J02Rik UTSW 9 103281043 missense possibly damaging 0.55
R7175:1300017J02Rik UTSW 9 103251789 critical splice donor site probably null
R7347:1300017J02Rik UTSW 9 103282646 missense possibly damaging 0.67
R7380:1300017J02Rik UTSW 9 103279481 nonsense probably null
R7460:1300017J02Rik UTSW 9 103254648 missense probably benign 0.00
R7993:1300017J02Rik UTSW 9 103263133 missense probably benign
R8056:1300017J02Rik UTSW 9 103266224 missense probably damaging 1.00
R8686:1300017J02Rik UTSW 9 103259428 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTTACCCATCTCACCAGCTATAAG -3'
(R):5'- CCAGTGAGGGTCTTAACTCATC -3'

Sequencing Primer
(F):5'- TTAGTAGATACTAAGCTCAGAGTCAC -3'
(R):5'- CAGTGAGGGTCTTAACTCATCTCAAC -3'
Posted On2019-09-13