Incidental Mutation 'R7400:1300017J02Rik'
ID 574109
Institutional Source Beutler Lab
Gene Symbol 1300017J02Rik
Ensembl Gene ENSMUSG00000033688
Gene Name RIKEN cDNA 1300017J02 gene
Synonyms mICA
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.194) question?
Stock # R7400 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 103250521-103305082 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 103250662 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Valine at position 690 (E690V)
Ref Sequence ENSEMBL: ENSMUSP00000035163 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035163] [ENSMUST00000123530]
AlphaFold Q9DBD0
PDB Structure Crystal Structure of the Murine Inhibitor of Carbonic Anhydrase [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000035163
AA Change: E690V

PolyPhen 2 Score 0.253 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000035163
Gene: ENSMUSG00000033688
AA Change: E690V

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
TR_FER 25 352 5.48e-163 SMART
TR_FER 355 697 3.26e-179 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123530
AA Change: E612V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000115867
Gene: ENSMUSG00000033688
AA Change: E612V

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
TR_FER 25 351 3.67e-164 SMART
TR_FER 352 619 5.89e-104 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000154357
SMART Domains Protein: ENSMUSP00000123519
Gene: ENSMUSG00000033688

DomainStartEndE-ValueType
TR_FER 1 242 5.88e-81 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 97% (69/71)
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik T C 2: 68,666,203 S118P unknown Het
Ahnak T A 19: 9,014,613 D4420E probably damaging Het
Atp5g2 C T 15: 102,665,112 A90T possibly damaging Het
Batf2 A G 19: 6,171,508 Y116C probably damaging Het
Cd48 G A 1: 171,695,925 R112H probably benign Het
Cdh8 A T 8: 99,279,560 Y132N probably damaging Het
Cfap70 A C 14: 20,408,267 S793A probably benign Het
Cmip A G 8: 117,257,405 probably null Het
Cyp1a2 T C 9: 57,681,940 N197S probably benign Het
Diaph1 T C 18: 37,854,502 D1067G probably damaging Het
Disp2 T C 2: 118,791,886 L1033P probably damaging Het
Dock6 G T 9: 21,801,807 A1981D possibly damaging Het
Eci3 T C 13: 34,959,977 D55G probably benign Het
Eea1 T A 10: 95,995,570 D174E probably benign Het
Ehd2 T C 7: 15,950,656 E406G possibly damaging Het
Erich3 A G 3: 154,762,577 K889E Het
Fat4 C A 3: 38,887,924 T322K probably damaging Het
Fitm1 A T 14: 55,576,769 I241F possibly damaging Het
Fscb C A 12: 64,471,617 S1025I unknown Het
Gm4070 T A 7: 105,902,040 I602F probably benign Het
Gpsm2 T A 3: 108,679,688 D644V probably damaging Het
Gucy2d C A 7: 98,443,640 L75M possibly damaging Het
Hmcn1 T C 1: 150,674,430 I2668V probably damaging Het
Hoxa7 A G 6: 52,217,053 I118T possibly damaging Het
Hsp90ab1 A G 17: 45,569,284 V473A probably benign Het
Ica1l T C 1: 60,042,642 probably null Het
Ighv1-72 A G 12: 115,758,217 S40P probably damaging Het
Kif28 A C 1: 179,700,274 W771G probably damaging Het
Klf13 G C 7: 63,938,248 A100G probably benign Het
Klhl5 A G 5: 65,148,590 E300G possibly damaging Het
Krt40 A G 11: 99,543,143 S6P probably benign Het
Map3k13 C T 16: 21,922,322 R800W probably damaging Het
Mef2d T C 3: 88,167,731 L408P possibly damaging Het
Mmp10 T A 9: 7,503,300 M87K probably damaging Het
Mrgprd T A 7: 145,321,906 H171Q probably benign Het
Muc1 C T 3: 89,230,646 T265I possibly damaging Het
Myo15b A G 11: 115,860,113 N570D Het
Nfs1 T A 2: 156,126,323 I408F probably damaging Het
Npdc1 G T 2: 25,406,245 C48F probably damaging Het
Olfr137 A T 17: 38,305,331 N43K possibly damaging Het
Olfr459 A T 6: 41,771,744 L185H probably damaging Het
Olfr592 T C 7: 103,187,380 S260P probably damaging Het
Olfr676 T C 7: 105,035,210 I4T probably benign Het
Osbpl2 T C 2: 180,153,321 M332T probably benign Het
Ostm1 T A 10: 42,698,217 V302D probably damaging Het
Otof T C 5: 30,385,188 D672G probably benign Het
Plekha6 A T 1: 133,274,024 K392* probably null Het
Pnpla1 A T 17: 28,858,976 D37V probably damaging Het
Rasgrp1 A G 2: 117,298,545 S198P probably damaging Het
Reln A T 5: 21,971,934 N1911K probably damaging Het
Ripply3 C A 16: 94,335,900 A140E probably benign Het
Siglec1 A G 2: 131,086,095 C8R possibly damaging Het
Slamf6 T C 1: 171,919,793 S41P unknown Het
Slc15a5 A G 6: 138,073,057 M120T probably benign Het
Slc25a20 T G 9: 108,681,973 D179E possibly damaging Het
Sltm T A 9: 70,586,070 V783E probably damaging Het
Smc1b C A 15: 85,069,720 R1116L probably damaging Het
Smim23 A G 11: 32,824,471 V16A probably benign Het
Spata20 A G 11: 94,483,400 V348A probably benign Het
Spen T C 4: 141,473,741 D2525G probably damaging Het
St14 A C 9: 31,108,275 N83K probably benign Het
Stab1 T C 14: 31,157,384 N713S probably null Het
Syne1 A T 10: 5,218,580 L5267H probably benign Het
Tenm4 T C 7: 96,694,803 L271P probably damaging Het
Tfap2d C T 1: 19,142,926 H325Y possibly damaging Het
Trav23 A G 14: 53,977,563 R78G probably benign Het
Ttc39c A T 18: 12,643,799 probably benign Het
Unc79 A G 12: 103,104,630 D1228G probably damaging Het
Vmn1r66 T A 7: 10,274,947 H53L probably damaging Het
Vps13b A T 15: 35,378,900 L53F probably damaging Het
Zfp532 C T 18: 65,638,913 T834M possibly damaging Het
Other mutations in 1300017J02Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01371:1300017J02Rik APN 9 103254776 missense possibly damaging 0.48
IGL02370:1300017J02Rik APN 9 103263074 missense probably benign 0.27
IGL02899:1300017J02Rik APN 9 103277574 missense probably damaging 1.00
R0206:1300017J02Rik UTSW 9 103282662 missense probably damaging 1.00
R0206:1300017J02Rik UTSW 9 103282662 missense probably damaging 1.00
R0831:1300017J02Rik UTSW 9 103269779 missense possibly damaging 0.50
R0849:1300017J02Rik UTSW 9 103263057 missense possibly damaging 0.94
R1225:1300017J02Rik UTSW 9 103254839 splice site probably benign
R2061:1300017J02Rik UTSW 9 103268314 missense probably benign 0.01
R2176:1300017J02Rik UTSW 9 103259367 splice site probably benign
R4915:1300017J02Rik UTSW 9 103251855 nonsense probably null
R4917:1300017J02Rik UTSW 9 103251855 nonsense probably null
R5020:1300017J02Rik UTSW 9 103282502 missense probably benign 0.02
R5033:1300017J02Rik UTSW 9 103279414 missense probably benign 0.36
R5087:1300017J02Rik UTSW 9 103266221 missense probably damaging 0.98
R5174:1300017J02Rik UTSW 9 103282556 splice site probably null
R6283:1300017J02Rik UTSW 9 103282635 nonsense probably null
R7092:1300017J02Rik UTSW 9 103281043 missense possibly damaging 0.55
R7175:1300017J02Rik UTSW 9 103251789 critical splice donor site probably null
R7347:1300017J02Rik UTSW 9 103282646 missense possibly damaging 0.67
R7380:1300017J02Rik UTSW 9 103279481 nonsense probably null
R7460:1300017J02Rik UTSW 9 103254648 missense probably benign 0.00
R7993:1300017J02Rik UTSW 9 103263133 missense probably benign
R8056:1300017J02Rik UTSW 9 103266224 missense probably damaging 1.00
R8686:1300017J02Rik UTSW 9 103259428 missense probably benign 0.00
R8869:1300017J02Rik UTSW 9 103272632 missense probably damaging 1.00
R9371:1300017J02Rik UTSW 9 103281053 missense probably benign 0.01
R9448:1300017J02Rik UTSW 9 103272582 missense probably benign
R9719:1300017J02Rik UTSW 9 103254815 missense probably benign 0.42
Predicted Primers PCR Primer
(F):5'- TTTACCCATCTCACCAGCTATAAG -3'
(R):5'- CCAGTGAGGGTCTTAACTCATC -3'

Sequencing Primer
(F):5'- TTAGTAGATACTAAGCTCAGAGTCAC -3'
(R):5'- CAGTGAGGGTCTTAACTCATCTCAAC -3'
Posted On 2019-09-13