Mutagenetix > Incidental Mutation

Incidental Mutation 'R7400:Smc1b'

574127

Institutional Source

Beutler Lab

Gene Symbol

Smc1b

Ensembl Gene

ENSMUSG00000022432

Gene Name

structural maintenance of chromosomes 1B

Synonyms

SMC1beta, Smc1l2

MMRRC Submission

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.691) question?

Stock #

R7400 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

85064689-85131964 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 85069720 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Leucine at position 1116 (R1116L)

Ref Sequence

ENSEMBL: ENSMUSP00000023068 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023068] [ENSMUST00000227591]

AlphaFold

Q920F6

Predicted Effect

probably damaging
Transcript: ENSMUST00000023068
AA Change: R1116L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000023068
Gene: ENSMUSG00000022432
AA Change: R1116L

Domain	Start	End	E-Value	Type
Pfam:AAA_23	7	361	2e-10	PFAM
Pfam:AAA_21	27	372	7.2e-9	PFAM
low complexity region	422	437	N/A	INTRINSIC
SMC_hinge	513	629	1.5e-23	SMART
PDB:1W1W\|D	1046	1218	3e-42	PDB
Blast:AAA	1063	1217	5e-25	BLAST
SCOP:d1e69a_	1114	1202	3e-5	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000227591

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

97% (69/71)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SMC1L2 belongs to a family of proteins required for chromatid cohesion and DNA recombination during meiosis and mitosis (3:Revenkova et al., 2001 [PubMed 11564881]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous mutant mice display male and female infertility, abnormal male and female meiosis, and arrest of spematogenesis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1300017J02Rik	T	A	9: 103,250,662	E690V	probably benign	Het
4932414N04Rik	T	C	2: 68,666,203	S118P	unknown	Het
Ahnak	T	A	19: 9,014,613	D4420E	probably damaging	Het
Atp5g2	C	T	15: 102,665,112	A90T	possibly damaging	Het
Batf2	A	G	19: 6,171,508	Y116C	probably damaging	Het
Cd48	G	A	1: 171,695,925	R112H	probably benign	Het
Cdh8	A	T	8: 99,279,560	Y132N	probably damaging	Het
Cfap70	A	C	14: 20,408,267	S793A	probably benign	Het
Cmip	A	G	8: 117,257,405		probably null	Het
Cyp1a2	T	C	9: 57,681,940	N197S	probably benign	Het
Diaph1	T	C	18: 37,854,502	D1067G	probably damaging	Het
Disp2	T	C	2: 118,791,886	L1033P	probably damaging	Het
Dock6	G	T	9: 21,801,807	A1981D	possibly damaging	Het
Eci3	T	C	13: 34,959,977	D55G	probably benign	Het
Eea1	T	A	10: 95,995,570	D174E	probably benign	Het
Ehd2	T	C	7: 15,950,656	E406G	possibly damaging	Het
Erich3	A	G	3: 154,762,577	K889E		Het
Fat4	C	A	3: 38,887,924	T322K	probably damaging	Het
Fitm1	A	T	14: 55,576,769	I241F	possibly damaging	Het
Fscb	C	A	12: 64,471,617	S1025I	unknown	Het
Gm4070	T	A	7: 105,902,040	I602F	probably benign	Het
Gpsm2	T	A	3: 108,679,688	D644V	probably damaging	Het
Gucy2d	C	A	7: 98,443,640	L75M	possibly damaging	Het
Hmcn1	T	C	1: 150,674,430	I2668V	probably damaging	Het
Hoxa7	A	G	6: 52,217,053	I118T	possibly damaging	Het
Hsp90ab1	A	G	17: 45,569,284	V473A	probably benign	Het
Ica1l	T	C	1: 60,042,642		probably null	Het
Ighv1-72	A	G	12: 115,758,217	S40P	probably damaging	Het
Kif28	A	C	1: 179,700,274	W771G	probably damaging	Het
Klf13	G	C	7: 63,938,248	A100G	probably benign	Het
Klhl5	A	G	5: 65,148,590	E300G	possibly damaging	Het
Krt40	A	G	11: 99,543,143	S6P	probably benign	Het
Map3k13	C	T	16: 21,922,322	R800W	probably damaging	Het
Mef2d	T	C	3: 88,167,731	L408P	possibly damaging	Het
Mmp10	T	A	9: 7,503,300	M87K	probably damaging	Het
Mrgprd	T	A	7: 145,321,906	H171Q	probably benign	Het
Muc1	C	T	3: 89,230,646	T265I	possibly damaging	Het
Myo15b	A	G	11: 115,860,113	N570D		Het
Nfs1	T	A	2: 156,126,323	I408F	probably damaging	Het
Npdc1	G	T	2: 25,406,245	C48F	probably damaging	Het
Olfr137	A	T	17: 38,305,331	N43K	possibly damaging	Het
Olfr459	A	T	6: 41,771,744	L185H	probably damaging	Het
Olfr592	T	C	7: 103,187,380	S260P	probably damaging	Het
Olfr676	T	C	7: 105,035,210	I4T	probably benign	Het
Osbpl2	T	C	2: 180,153,321	M332T	probably benign	Het
Ostm1	T	A	10: 42,698,217	V302D	probably damaging	Het
Otof	T	C	5: 30,385,188	D672G	probably benign	Het
Plekha6	A	T	1: 133,274,024	K392*	probably null	Het
Pnpla1	A	T	17: 28,858,976	D37V	probably damaging	Het
Rasgrp1	A	G	2: 117,298,545	S198P	probably damaging	Het
Reln	A	T	5: 21,971,934	N1911K	probably damaging	Het
Ripply3	C	A	16: 94,335,900	A140E	probably benign	Het
Siglec1	A	G	2: 131,086,095	C8R	possibly damaging	Het
Slamf6	T	C	1: 171,919,793	S41P	unknown	Het
Slc15a5	A	G	6: 138,073,057	M120T	probably benign	Het
Slc25a20	T	G	9: 108,681,973	D179E	possibly damaging	Het
Sltm	T	A	9: 70,586,070	V783E	probably damaging	Het
Smim23	A	G	11: 32,824,471	V16A	probably benign	Het
Spata20	A	G	11: 94,483,400	V348A	probably benign	Het
Spen	T	C	4: 141,473,741	D2525G	probably damaging	Het
St14	A	C	9: 31,108,275	N83K	probably benign	Het
Stab1	T	C	14: 31,157,384	N713S	probably null	Het
Syne1	A	T	10: 5,218,580	L5267H	probably benign	Het
Tenm4	T	C	7: 96,694,803	L271P	probably damaging	Het
Tfap2d	C	T	1: 19,142,926	H325Y	possibly damaging	Het
Trav23	A	G	14: 53,977,563	R78G	probably benign	Het
Ttc39c	A	T	18: 12,643,799		probably benign	Het
Unc79	A	G	12: 103,104,630	D1228G	probably damaging	Het
Vmn1r66	T	A	7: 10,274,947	H53L	probably damaging	Het
Vps13b	A	T	15: 35,378,900	L53F	probably damaging	Het
Zfp532	C	T	18: 65,638,913	T834M	possibly damaging	Het

Other mutations in Smc1b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00736:Smc1b	APN	15	85129700	missense	possibly damaging	0.95
IGL01293:Smc1b	APN	15	85131898	missense	probably damaging	1.00
IGL01656:Smc1b	APN	15	85114776	missense	probably damaging	0.99
IGL01807:Smc1b	APN	15	85096745	missense	probably damaging	0.97
IGL02094:Smc1b	APN	15	85097891	splice site	probably benign
IGL02121:Smc1b	APN	15	85097985	missense	probably benign
IGL02631:Smc1b	APN	15	85107003	missense	probably damaging	0.98
IGL02678:Smc1b	APN	15	85065000	nonsense	probably null
IGL03197:Smc1b	APN	15	85070863	missense	possibly damaging	0.85
IGL03214:Smc1b	APN	15	85097946	nonsense	probably null
IGL03218:Smc1b	APN	15	85089713	missense	probably benign	0.07
IGL03232:Smc1b	APN	15	85129720	missense	possibly damaging	0.68
adamantine	UTSW	15	85121641	missense	probably benign	0.06
unbreakable	UTSW	15	85096658	missense	probably benign
E0370:Smc1b	UTSW	15	85127581	missense	probably damaging	1.00
PIT4812001:Smc1b	UTSW	15	85069651	missense	possibly damaging	0.91
R0092:Smc1b	UTSW	15	85067724	unclassified	probably benign
R0106:Smc1b	UTSW	15	85070819	missense	probably damaging	1.00
R0106:Smc1b	UTSW	15	85070819	missense	probably damaging	1.00
R0207:Smc1b	UTSW	15	85123759	missense	probably benign
R0390:Smc1b	UTSW	15	85066277	missense	probably damaging	1.00
R0440:Smc1b	UTSW	15	85112673	splice site	probably benign
R0685:Smc1b	UTSW	15	85070820	missense	possibly damaging	0.92
R1109:Smc1b	UTSW	15	85112815	missense	probably damaging	0.98
R1392:Smc1b	UTSW	15	85107070	splice site	probably benign
R1509:Smc1b	UTSW	15	85086134	missense	probably benign
R1804:Smc1b	UTSW	15	85127790	missense	possibly damaging	0.90
R1879:Smc1b	UTSW	15	85092067	missense	probably benign	0.01
R2086:Smc1b	UTSW	15	85121851	splice site	probably benign
R2143:Smc1b	UTSW	15	85123802	missense	probably benign
R2158:Smc1b	UTSW	15	85121851	splice site	probably benign
R2174:Smc1b	UTSW	15	85121851	splice site	probably benign
R2471:Smc1b	UTSW	15	85092017	missense	probably damaging	0.98
R3689:Smc1b	UTSW	15	85117263	intron	probably benign
R3690:Smc1b	UTSW	15	85117263	intron	probably benign
R4178:Smc1b	UTSW	15	85120647	missense	possibly damaging	0.94
R4420:Smc1b	UTSW	15	85112830	missense	probably damaging	1.00
R4905:Smc1b	UTSW	15	85066227	missense	probably damaging	1.00
R4919:Smc1b	UTSW	15	85117104	intron	probably benign
R5114:Smc1b	UTSW	15	85064984	missense	probably damaging	1.00
R5314:Smc1b	UTSW	15	85070865	missense	probably benign	0.00
R5476:Smc1b	UTSW	15	85086151	missense	probably damaging	0.97
R5593:Smc1b	UTSW	15	85121641	missense	probably benign	0.06
R5690:Smc1b	UTSW	15	85112773	missense	probably damaging	1.00
R5719:Smc1b	UTSW	15	85096658	missense	probably benign
R5817:Smc1b	UTSW	15	85067783	missense	probably damaging	0.99
R5834:Smc1b	UTSW	15	85089665	missense	probably damaging	1.00
R5930:Smc1b	UTSW	15	85086121	missense	probably damaging	1.00
R6032:Smc1b	UTSW	15	85066229	missense	possibly damaging	0.92
R6032:Smc1b	UTSW	15	85066229	missense	possibly damaging	0.92
R6049:Smc1b	UTSW	15	85121695	missense	probably damaging	1.00
R6306:Smc1b	UTSW	15	85127623	missense	probably benign	0.30
R6392:Smc1b	UTSW	15	85092031	missense	probably benign	0.03
R6426:Smc1b	UTSW	15	85092031	missense	probably benign	0.03
R6435:Smc1b	UTSW	15	85092031	missense	probably benign	0.03
R6436:Smc1b	UTSW	15	85092031	missense	probably benign	0.03
R6437:Smc1b	UTSW	15	85092031	missense	probably benign	0.03
R6508:Smc1b	UTSW	15	85092031	missense	probably benign	0.03
R6512:Smc1b	UTSW	15	85092031	missense	probably benign	0.03
R6703:Smc1b	UTSW	15	85092031	missense	probably benign	0.03
R6737:Smc1b	UTSW	15	85092031	missense	probably benign	0.03
R6775:Smc1b	UTSW	15	85089680	missense	probably damaging	0.96
R6889:Smc1b	UTSW	15	85067759	missense	probably damaging	1.00
R6908:Smc1b	UTSW	15	85107010	missense	probably damaging	1.00
R7124:Smc1b	UTSW	15	85071597	missense	probably damaging	0.98
R7417:Smc1b	UTSW	15	85097542	missense	probably benign	0.05
R7610:Smc1b	UTSW	15	85070820	missense	possibly damaging	0.92
R7873:Smc1b	UTSW	15	85110650	critical splice donor site	probably null
R7890:Smc1b	UTSW	15	85066328	missense	probably damaging	1.00
R8004:Smc1b	UTSW	15	85097614	missense	probably damaging	0.98
R8698:Smc1b	UTSW	15	85112846	missense	probably benign	0.16
R8826:Smc1b	UTSW	15	85066328	missense	probably damaging	1.00
R8835:Smc1b	UTSW	15	85129748	missense	possibly damaging	0.83
R8925:Smc1b	UTSW	15	85107072	splice site	probably null
R9059:Smc1b	UTSW	15	85120674	nonsense	probably null
R9149:Smc1b	UTSW	15	85066230	missense	probably benign	0.00
R9241:Smc1b	UTSW	15	85092008	missense	probably benign	0.00
R9245:Smc1b	UTSW	15	85120645	missense	probably benign	0.03
R9301:Smc1b	UTSW	15	85127794	missense	probably damaging	0.98
R9384:Smc1b	UTSW	15	85066254	missense	probably damaging	0.99
R9750:Smc1b	UTSW	15	85131905	missense	probably damaging	1.00
Z1176:Smc1b	UTSW	15	85131903	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGACTGGAAGGATAGCTTTGC -3'
(R):5'- TGCACAACTAAGTGGATTTACAGG -3'

Sequencing Primer
(F):5'- GTAACTTGCTGTGGCCTT -3'
(R):5'- TTTTTCCCATCAAAACTGAGGAAACC -3'

Posted On

2019-09-13