Incidental Mutation 'R7400:Olfr137'
ID574132
Institutional Source Beutler Lab
Gene Symbol Olfr137
Ensembl Gene ENSMUSG00000054940
Gene Nameolfactory receptor 137
SynonymsMOR256-18, GA_x6K02T2PSCP-2749525-2748587
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.192) question?
Stock #R7400 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location38303527-38307570 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 38305331 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 43 (N43K)
Ref Sequence ENSEMBL: ENSMUSP00000150173 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057394] [ENSMUST00000213505]
Predicted Effect possibly damaging
Transcript: ENSMUST00000057394
AA Change: N43K

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000051537
Gene: ENSMUSG00000054940
AA Change: N43K

DomainStartEndE-ValueType
Pfam:7tm_4 32 308 4e-49 PFAM
Pfam:7tm_1 42 291 4.5e-28 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000213505
AA Change: N43K

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 97% (69/71)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik T A 9: 103,250,662 E690V probably benign Het
4932414N04Rik T C 2: 68,666,203 S118P unknown Het
Ahnak T A 19: 9,014,613 D4420E probably damaging Het
Atp5g2 C T 15: 102,665,112 A90T possibly damaging Het
Batf2 A G 19: 6,171,508 Y116C probably damaging Het
Cd48 G A 1: 171,695,925 R112H probably benign Het
Cdh8 A T 8: 99,279,560 Y132N probably damaging Het
Cfap70 A C 14: 20,408,267 S793A probably benign Het
Cmip A G 8: 117,257,405 probably null Het
Cyp1a2 T C 9: 57,681,940 N197S probably benign Het
Diaph1 T C 18: 37,854,502 D1067G probably damaging Het
Disp2 T C 2: 118,791,886 L1033P probably damaging Het
Dock6 G T 9: 21,801,807 A1981D possibly damaging Het
Eci3 T C 13: 34,959,977 D55G probably benign Het
Eea1 T A 10: 95,995,570 D174E probably benign Het
Ehd2 T C 7: 15,950,656 E406G possibly damaging Het
Erich3 A G 3: 154,762,577 K889E Het
Fat4 C A 3: 38,887,924 T322K probably damaging Het
Fitm1 A T 14: 55,576,769 I241F possibly damaging Het
Fscb C A 12: 64,471,617 S1025I unknown Het
Gm4070 T A 7: 105,902,040 I602F probably benign Het
Gpsm2 T A 3: 108,679,688 D644V probably damaging Het
Gucy2d C A 7: 98,443,640 L75M possibly damaging Het
Hmcn1 T C 1: 150,674,430 I2668V probably damaging Het
Hoxa7 A G 6: 52,217,053 I118T possibly damaging Het
Hsp90ab1 A G 17: 45,569,284 V473A probably benign Het
Ica1l T C 1: 60,042,642 probably null Het
Ighv1-72 A G 12: 115,758,217 S40P probably damaging Het
Kif28 A C 1: 179,700,274 W771G probably damaging Het
Klf13 G C 7: 63,938,248 A100G probably benign Het
Klhl5 A G 5: 65,148,590 E300G possibly damaging Het
Krt40 A G 11: 99,543,143 S6P probably benign Het
Map3k13 C T 16: 21,922,322 R800W probably damaging Het
Mef2d T C 3: 88,167,731 L408P possibly damaging Het
Mmp10 T A 9: 7,503,300 M87K probably damaging Het
Mrgprd T A 7: 145,321,906 H171Q probably benign Het
Muc1 C T 3: 89,230,646 T265I possibly damaging Het
Myo15b A G 11: 115,860,113 N570D Het
Nfs1 T A 2: 156,126,323 I408F probably damaging Het
Npdc1 G T 2: 25,406,245 C48F probably damaging Het
Olfr459 A T 6: 41,771,744 L185H probably damaging Het
Olfr592 T C 7: 103,187,380 S260P probably damaging Het
Olfr676 T C 7: 105,035,210 I4T probably benign Het
Osbpl2 T C 2: 180,153,321 M332T probably benign Het
Ostm1 T A 10: 42,698,217 V302D probably damaging Het
Otof T C 5: 30,385,188 D672G probably benign Het
Plekha6 A T 1: 133,274,024 K392* probably null Het
Pnpla1 A T 17: 28,858,976 D37V probably damaging Het
Rasgrp1 A G 2: 117,298,545 S198P probably damaging Het
Reln A T 5: 21,971,934 N1911K probably damaging Het
Ripply3 C A 16: 94,335,900 A140E probably benign Het
Siglec1 A G 2: 131,086,095 C8R possibly damaging Het
Slamf6 T C 1: 171,919,793 S41P unknown Het
Slc15a5 A G 6: 138,073,057 M120T probably benign Het
Slc25a20 T G 9: 108,681,973 D179E possibly damaging Het
Sltm T A 9: 70,586,070 V783E probably damaging Het
Smc1b C A 15: 85,069,720 R1116L probably damaging Het
Smim23 A G 11: 32,824,471 V16A probably benign Het
Spata20 A G 11: 94,483,400 V348A probably benign Het
Spen T C 4: 141,473,741 D2525G probably damaging Het
St14 A C 9: 31,108,275 N83K probably benign Het
Stab1 T C 14: 31,157,384 N713S probably null Het
Syne1 A T 10: 5,218,580 L5267H probably benign Het
Tenm4 T C 7: 96,694,803 L271P probably damaging Het
Tfap2d C T 1: 19,142,926 H325Y possibly damaging Het
Trav23 A G 14: 53,977,563 R78G probably benign Het
Ttc39c A T 18: 12,643,799 probably benign Het
Unc79 A G 12: 103,104,630 D1228G probably damaging Het
Vmn1r66 T A 7: 10,274,947 H53L probably damaging Het
Vps13b A T 15: 35,378,900 L53F probably damaging Het
Zfp532 C T 18: 65,638,913 T834M possibly damaging Het
Other mutations in Olfr137
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02131:Olfr137 APN 17 38304648 missense probably benign 0.03
IGL03169:Olfr137 APN 17 38305101 missense probably damaging 1.00
IGL03392:Olfr137 APN 17 38304895 missense probably benign 0.02
R0055:Olfr137 UTSW 17 38304811 missense possibly damaging 0.84
R0055:Olfr137 UTSW 17 38304811 missense possibly damaging 0.84
R0496:Olfr137 UTSW 17 38304658 missense probably damaging 0.99
R0761:Olfr137 UTSW 17 38305391 missense probably benign 0.00
R1126:Olfr137 UTSW 17 38304688 missense probably damaging 0.97
R1835:Olfr137 UTSW 17 38305312 missense probably benign 0.02
R3727:Olfr137 UTSW 17 38305419 missense possibly damaging 0.64
R5556:Olfr137 UTSW 17 38305073 missense possibly damaging 0.71
R5979:Olfr137 UTSW 17 38305192 missense probably benign
R6430:Olfr137 UTSW 17 38305358 missense probably benign 0.04
R6433:Olfr137 UTSW 17 38305413 missense probably damaging 1.00
R8053:Olfr137 UTSW 17 38305210 missense probably benign
R8199:Olfr137 UTSW 17 38304553 missense probably benign 0.31
R8446:Olfr137 UTSW 17 38304747 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TAGCGGTCATAGGACATCACC -3'
(R):5'- CTCTTCATGTTTTCTAGAGCTGAGG -3'

Sequencing Primer
(F):5'- ACTCTGTGGTACCCAGAGCAAG -3'
(R):5'- TGTTTTCTAGAGCTGAGGATAAAAC -3'
Posted On2019-09-13