Mutagenetix > Incidental Mutations

Incidental Mutation 'R0625:Adgrd1'

57414

Institutional Source

Beutler Lab

Gene Symbol

Adgrd1

Ensembl Gene

ENSMUSG00000044017

Gene Name

adhesion G protein-coupled receptor D1

Synonyms

E230012M21Rik, Gpr133

MMRRC Submission

038814-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0625 (G1)

Quality Score

Status

Not validated

Chromosome

Chromosomal Location

129096750-129204599 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to C at 129171931 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000121217 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000056617] [ENSMUST00000156437]

Predicted Effect

probably null
Transcript: ENSMUST00000056617

SMART Domains

Protein: ENSMUSP00000060307
Gene: ENSMUSG00000044017

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
Pfam:Laminin_G_3	119	273	2.9e-18	PFAM
Pfam:Pentaxin	171	288	2.2e-7	PFAM
GPS	535	585	1.57e-14	SMART
Pfam:Dicty_CAR	590	856	1.2e-8	PFAM
Pfam:7tm_2	592	831	8e-58	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000156437

SMART Domains

Protein: ENSMUSP00000121217
Gene: ENSMUSG00000044017

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.5%
20x: 95.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The adhesion G-protein-coupled receptors (GPCRs), including GPR133, are membrane-bound proteins with long N termini containing multiple domains. GPCRs, or GPRs, contain 7 transmembrane domains and transduce extracellular signals through heterotrimeric G proteins (summary by Bjarnadottir et al., 2004 [PubMed 15203201]).[supplied by OMIM, Nov 2010]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930550C14Rik	T	C	9: 53,408,065	S2P	probably benign	Het
Abca16	A	C	7: 120,435,893	T301P	probably damaging	Het
Acer2	A	G	4: 86,887,162	D121G	possibly damaging	Het
Arhgap11a	T	C	2: 113,841,711	I249V	probably benign	Het
Arhgap22	A	G	14: 33,366,714	E219G	probably benign	Het
C2cd4b	T	A	9: 67,759,751	S10T	probably benign	Het
Cnot6	A	T	11: 49,683,171	I224N	probably damaging	Het
Ctrc	T	C	4: 141,841,518	T125A	probably damaging	Het
Cxxc5	T	G	18: 35,858,589	S14R	unknown	Het
Cyp4f37	T	G	17: 32,634,678	F445L	probably damaging	Het
Dcbld1	T	G	10: 52,312,850	I186S	probably benign	Het
Dmxl2	T	C	9: 54,382,702	T2510A	probably benign	Het
Dnah3	A	G	7: 120,071,887	I591T	possibly damaging	Het
Dock5	A	T	14: 67,841,163	I204N	probably benign	Het
Dysf	G	A	6: 84,111,987		probably null	Het
Erich5	A	G	15: 34,471,369	E248G	probably damaging	Het
Fam160a1	A	G	3: 85,730,500	V164A	possibly damaging	Het
Foxm1	A	G	6: 128,373,871	S712G	probably damaging	Het
Frmpd1	A	G	4: 45,284,055	T959A	probably benign	Het
Gfra4	C	T	2: 131,040,256	V277I	probably null	Het
Hacd4	T	C	4: 88,435,010	I82V	probably benign	Het
Itih2	C	T	2: 10,123,414	V159I	possibly damaging	Het
Itpr2	T	A	6: 146,166,651	M2410L	probably benign	Het
March11	A	G	15: 26,311,043	I202V	probably damaging	Het
March3	A	G	18: 56,811,830		probably null	Het
Med12l	G	A	3: 59,247,437	E1135K	probably damaging	Het
Mib2	C	T	4: 155,659,460	G42S	probably damaging	Het
Mlx	T	C	11: 101,087,782	L78P	possibly damaging	Het
Muc5b	T	C	7: 141,846,427	C473R	unknown	Het
N4bp2l1	T	A	5: 150,576,745	R66*	probably null	Het
Nes	A	G	3: 87,977,172	T913A	possibly damaging	Het
Oas1a	T	C	5: 120,899,259	E235G	probably damaging	Het
Olfr1104	T	A	2: 87,021,620	H308L	probably benign	Het
Olfr477	T	C	7: 107,991,189	S275P	probably damaging	Het
Olfr905	T	C	9: 38,473,208	S154P	possibly damaging	Het
Parn	C	T	16: 13,640,294	V286I	probably benign	Het
Paxip1	G	A	5: 27,765,942	Q470*	probably null	Het
Phc2	C	G	4: 128,723,710	H510D	possibly damaging	Het
Pla2g4f	T	A	2: 120,305,041	D384V	probably damaging	Het
Plpbp	A	T	8: 27,045,131	N68I	probably damaging	Het
Podxl2	G	A	6: 88,849,955	A123V	possibly damaging	Het
Pole	A	T	5: 110,325,550	T1737S	possibly damaging	Het
Ppp3cc	T	C	14: 70,225,027	E396G	probably damaging	Het
Pramel7	T	A	2: 87,491,008	I228F	probably benign	Het
Prl7d1	A	T	13: 27,710,140	C149S	probably benign	Het
Qtrt1	G	T	9: 21,418,288	M217I	probably benign	Het
Sec24a	T	A	11: 51,729,454	D456V	probably damaging	Het
Shox2	T	G	3: 66,981,544		probably null	Het
Skint2	T	A	4: 112,624,086	S49T	probably damaging	Het
Smarca5	A	G	8: 80,720,686		probably null	Het
Sorcs2	T	A	5: 36,024,572	D1068V	possibly damaging	Het
Tmem114	T	C	16: 8,412,102		probably null	Het
Ttc7b	T	A	12: 100,355,046	M24L	probably benign	Het
Ttll3	A	G	6: 113,408,903		probably null	Het
Usp7	C	T	16: 8,704,982	D102N	probably benign	Het

Other mutations in Adgrd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01084:Adgrd1	APN	5	129139592	missense	probably benign	0.06
IGL01384:Adgrd1	APN	5	129097209	missense	possibly damaging	0.47
IGL01636:Adgrd1	APN	5	129142452	splice site	probably benign
IGL01916:Adgrd1	APN	5	129132838	missense	probably benign	0.12
IGL01923:Adgrd1	APN	5	129178079	missense	possibly damaging	0.58
IGL02019:Adgrd1	APN	5	129115138	missense	probably benign	0.00
IGL02142:Adgrd1	APN	5	129131584	missense	probably benign
IGL02149:Adgrd1	APN	5	129179261	missense	probably damaging	1.00
IGL02190:Adgrd1	APN	5	129140724	splice site	probably benign
IGL02623:Adgrd1	APN	5	129132745	missense	probably damaging	0.99
IGL02696:Adgrd1	APN	5	129140854	splice site	probably benign
IGL02850:Adgrd1	APN	5	129115055	missense	probably damaging	1.00
IGL02976:Adgrd1	APN	5	129131597	missense	probably benign	0.00
IGL02988:Adgrd1	UTSW	5	129144010	missense	probably benign	0.00
PIT4458001:Adgrd1	UTSW	5	129131577	missense	probably damaging	1.00
R0081:Adgrd1	UTSW	5	129178082	missense	probably damaging	0.99
R0266:Adgrd1	UTSW	5	129139594	missense	probably benign	0.00
R0267:Adgrd1	UTSW	5	129139594	missense	probably benign	0.00
R0464:Adgrd1	UTSW	5	129162650	missense	probably damaging	1.00
R1288:Adgrd1	UTSW	5	129129007	missense	probably damaging	0.97
R1460:Adgrd1	UTSW	5	129122563	missense	possibly damaging	0.63
R1635:Adgrd1	UTSW	5	129128907	missense	probably damaging	1.00
R1658:Adgrd1	UTSW	5	129178100	missense	probably benign	0.02
R1709:Adgrd1	UTSW	5	129179228	missense	possibly damaging	0.95
R1897:Adgrd1	UTSW	5	129129001	missense	probably benign	0.01
R1976:Adgrd1	UTSW	5	129140797	missense	probably benign	0.06
R2049:Adgrd1	UTSW	5	129115095	missense	probably benign	0.01
R2259:Adgrd1	UTSW	5	129112311	missense	possibly damaging	0.92
R2295:Adgrd1	UTSW	5	129122506	missense	probably benign	0.13
R3076:Adgrd1	UTSW	5	129129105	missense	probably benign	0.20
R3077:Adgrd1	UTSW	5	129129105	missense	probably benign	0.20
R3078:Adgrd1	UTSW	5	129129105	missense	probably benign	0.20
R4581:Adgrd1	UTSW	5	129202531	missense	possibly damaging	0.68
R5024:Adgrd1	UTSW	5	129171895	missense	probably damaging	1.00
R5076:Adgrd1	UTSW	5	129143989	nonsense	probably null
R5227:Adgrd1	UTSW	5	129122583	missense	probably benign	0.00
R5453:Adgrd1	UTSW	5	129179583	missense	probably damaging	0.99
R6349:Adgrd1	UTSW	5	129142539	splice site	probably null
R6953:Adgrd1	UTSW	5	129115078	nonsense	probably null
R7300:Adgrd1	UTSW	5	129097347	critical splice donor site	probably null
R7583:Adgrd1	UTSW	5	129179588	missense	probably benign	0.42
R7622:Adgrd1	UTSW	5	129139624	missense	probably benign	0.27
R8205:Adgrd1	UTSW	5	129115111	missense	possibly damaging	0.94
X0067:Adgrd1	UTSW	5	129188352	missense	probably benign	0.06

Predicted Primers

PCR Primer
(F):5'- ACTGATCATGCCTGTTCATTGTGCC -3'
(R):5'- TGGATGCTCACTTGCTCAACTGTC -3'

Sequencing Primer
(F):5'- ATTGTGCCCTCAGCTCCG -3'
(R):5'- TAATAAGTTACCTCCAAGGGCAG -3'

Posted On

2013-07-11