Incidental Mutation 'R7401:Prpf40a'
ID 574144
Institutional Source Beutler Lab
Gene Symbol Prpf40a
Ensembl Gene ENSMUSG00000061136
Gene Name pre-mRNA processing factor 40A
Synonyms 2810012K09Rik, FBP11, Fnbp3
MMRRC Submission 045483-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7401 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 53024714-53081450 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 53046959 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 259 (V259A)
Ref Sequence ENSEMBL: ENSMUSP00000075655 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076313] [ENSMUST00000125243] [ENSMUST00000209364] [ENSMUST00000209508] [ENSMUST00000210789] [ENSMUST00000211102] [ENSMUST00000211712]
AlphaFold Q9R1C7
Predicted Effect probably benign
Transcript: ENSMUST00000076313
AA Change: V259A

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000075655
Gene: ENSMUSG00000061136
AA Change: V259A

DomainStartEndE-ValueType
low complexity region 77 124 N/A INTRINSIC
WW 141 173 7.54e-13 SMART
WW 182 214 1.57e-10 SMART
low complexity region 272 294 N/A INTRINSIC
FF 389 443 1.32e-17 SMART
FF 456 515 4.22e1 SMART
FF 523 583 1.11e-10 SMART
FF 603 663 4.31e0 SMART
low complexity region 670 682 N/A INTRINSIC
FF 739 795 7.43e-12 SMART
low complexity region 802 879 N/A INTRINSIC
low complexity region 883 923 N/A INTRINSIC
low complexity region 929 939 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125243
SMART Domains Protein: ENSMUSP00000117406
Gene: ENSMUSG00000061136

DomainStartEndE-ValueType
low complexity region 35 82 N/A INTRINSIC
WW 99 131 7.54e-13 SMART
WW 140 172 1.57e-10 SMART
low complexity region 230 252 N/A INTRINSIC
FF 347 401 1.32e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000209364
AA Change: V232A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000209508
Predicted Effect probably benign
Transcript: ENSMUST00000210789
AA Change: V217A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000211102
Predicted Effect probably benign
Transcript: ENSMUST00000211712
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610318N02Rik A T 16: 16,936,268 (GRCm39) L152Q probably benign Het
Abcg3 A T 5: 105,114,640 (GRCm39) N292K probably damaging Het
Adamts3 T A 5: 89,855,309 (GRCm39) probably null Het
Adgrg7 T C 16: 56,562,781 (GRCm39) N519D probably benign Het
Adsl A G 15: 80,846,983 (GRCm39) H263R probably damaging Het
Ak9 A T 10: 41,299,000 (GRCm39) D1567V unknown Het
Bscl2 T C 19: 8,823,914 (GRCm39) F280L possibly damaging Het
Cacna1b T A 2: 24,569,306 (GRCm39) T873S probably benign Het
Cacna1c T C 6: 119,029,669 (GRCm39) probably null Het
Cast G T 13: 74,956,577 (GRCm39) A18E unknown Het
Cd207 A C 6: 83,654,830 (GRCm39) probably benign Het
Cd79b A G 11: 106,203,678 (GRCm39) S130P probably benign Het
Cfap52 A T 11: 67,840,459 (GRCm39) N157K probably benign Het
Cfap57 C T 4: 118,472,128 (GRCm39) V84I probably benign Het
Chaf1b G T 16: 93,681,268 (GRCm39) probably benign Het
Cntn1 A G 15: 92,215,870 (GRCm39) I968V probably benign Het
Cntn5 C T 9: 9,833,466 (GRCm39) V362I probably benign Het
Crem A G 18: 3,295,329 (GRCm39) S80P probably damaging Het
Csnk1g3 C T 18: 54,063,390 (GRCm39) T267I probably damaging Het
Cyth1 A T 11: 118,073,077 (GRCm39) N274K possibly damaging Het
Dicer1 C T 12: 104,678,537 (GRCm39) G594S probably benign Het
Enpp1 C T 10: 24,521,180 (GRCm39) C849Y probably damaging Het
Fam193a A G 5: 34,622,979 (GRCm39) E1189G possibly damaging Het
Fermt1 C A 2: 132,759,479 (GRCm39) V426L probably benign Het
Fes A G 7: 80,028,524 (GRCm39) probably null Het
Gmeb1 C A 4: 131,953,085 (GRCm39) L560F probably damaging Het
Hace1 T C 10: 45,546,722 (GRCm39) L452P probably damaging Het
Hecw2 T A 1: 53,943,502 (GRCm39) H975L probably damaging Het
Idh2 GGTCCCAG GG 7: 79,748,077 (GRCm39) probably benign Het
Il1r2 T A 1: 40,162,370 (GRCm39) C338S probably damaging Het
Iqcn T C 8: 71,169,921 (GRCm39) I1337T probably benign Het
Kcnb1 T C 2: 167,030,204 (GRCm39) S114G probably damaging Het
Lce1c A T 3: 92,587,623 (GRCm39) T17S unknown Het
Lhfpl4 C A 6: 113,153,627 (GRCm39) L141F possibly damaging Het
Ms4a14 T C 19: 11,279,594 (GRCm39) E988G possibly damaging Het
Naip5 G T 13: 100,356,205 (GRCm39) Q1137K not run Het
Naip5 T C 13: 100,356,204 (GRCm39) Q1137R probably benign Het
Neurod1 T A 2: 79,285,290 (GRCm39) D31V probably benign Het
Neurod4 A G 10: 130,106,927 (GRCm39) C116R probably damaging Het
Nisch A G 14: 30,928,537 (GRCm39) V28A probably benign Het
Odad1 A C 7: 45,592,189 (GRCm39) Q323P probably damaging Het
Or4a72 A G 2: 89,405,449 (GRCm39) V207A probably benign Het
Or5d44 T G 2: 88,141,772 (GRCm39) M123L probably benign Het
Pabpc4l T A 3: 46,401,024 (GRCm39) R207W probably damaging Het
Pabpc4l A T 3: 46,400,687 (GRCm39) I319N probably damaging Het
Pcm1 G A 8: 41,762,568 (GRCm39) D1371N probably damaging Het
Peg10 G GGTC 6: 4,756,452 (GRCm39) probably benign Het
Plxnc1 C T 10: 94,706,867 (GRCm39) A557T probably benign Het
Prkdc T A 16: 15,466,602 (GRCm39) V58D probably damaging Het
Psmd3 A T 11: 98,576,466 (GRCm39) T123S probably benign Het
Ptgr2 G T 12: 84,339,103 (GRCm39) probably benign Het
Ptprr A G 10: 115,884,141 (GRCm39) H66R probably benign Het
Rftn2 A G 1: 55,233,401 (GRCm39) probably null Het
Rsph14 T A 10: 74,865,628 (GRCm39) E70V possibly damaging Het
Slc24a5 G A 2: 124,930,111 (GRCm39) V471I probably benign Het
Sorbs1 G C 19: 40,365,244 (GRCm39) R180G probably benign Het
Spag9 A T 11: 93,988,515 (GRCm39) T862S probably benign Het
Ssbp2 T A 13: 91,839,002 (GRCm39) D291E probably benign Het
Supt5 T C 7: 28,023,197 (GRCm39) K329E probably damaging Het
Syne2 G T 12: 76,014,155 (GRCm39) K3115N probably damaging Het
Tars1 A T 15: 11,392,095 (GRCm39) L239* probably null Het
Tbxa2r T C 10: 81,168,625 (GRCm39) Y105H probably benign Het
Tesk1 T A 4: 43,445,743 (GRCm39) D265E probably damaging Het
Tril T C 6: 53,795,266 (GRCm39) D652G possibly damaging Het
Tsga10 T C 1: 37,873,268 (GRCm39) R204G probably null Het
Twnk A G 19: 45,000,219 (GRCm39) D645G probably benign Het
Umodl1 A T 17: 31,217,122 (GRCm39) D1118V probably damaging Het
Unc119 T C 11: 78,238,071 (GRCm39) I83T probably benign Het
Unc80 T C 1: 66,685,574 (GRCm39) W2233R possibly damaging Het
Vmn1r45 T A 6: 89,910,416 (GRCm39) T185S possibly damaging Het
Vmn2r111 G T 17: 22,790,067 (GRCm39) T313K possibly damaging Het
Wdr4 A G 17: 31,728,806 (GRCm39) L123S probably damaging Het
Zfpm2 A G 15: 40,966,386 (GRCm39) E957G possibly damaging Het
Other mutations in Prpf40a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00327:Prpf40a APN 2 53,040,700 (GRCm39) missense probably benign 0.00
IGL00533:Prpf40a APN 2 53,035,355 (GRCm39) missense probably damaging 1.00
IGL01099:Prpf40a APN 2 53,031,847 (GRCm39) missense probably benign 0.00
IGL02039:Prpf40a APN 2 53,034,815 (GRCm39) missense probably damaging 1.00
IGL02608:Prpf40a APN 2 53,036,165 (GRCm39) missense probably damaging 0.97
I1329:Prpf40a UTSW 2 53,066,407 (GRCm39) missense probably benign 0.01
R0284:Prpf40a UTSW 2 53,040,659 (GRCm39) missense probably damaging 1.00
R0401:Prpf40a UTSW 2 53,049,325 (GRCm39) missense probably damaging 0.99
R0544:Prpf40a UTSW 2 53,031,663 (GRCm39) unclassified probably benign
R0582:Prpf40a UTSW 2 53,035,704 (GRCm39) missense probably damaging 1.00
R1533:Prpf40a UTSW 2 53,035,852 (GRCm39) missense probably damaging 1.00
R2057:Prpf40a UTSW 2 53,034,851 (GRCm39) missense probably damaging 1.00
R4274:Prpf40a UTSW 2 53,036,184 (GRCm39) missense probably damaging 1.00
R4604:Prpf40a UTSW 2 53,032,035 (GRCm39) missense probably damaging 0.99
R4814:Prpf40a UTSW 2 53,080,032 (GRCm39) missense probably damaging 1.00
R4976:Prpf40a UTSW 2 53,034,861 (GRCm39) missense probably damaging 1.00
R5119:Prpf40a UTSW 2 53,034,861 (GRCm39) missense probably damaging 1.00
R5378:Prpf40a UTSW 2 53,035,888 (GRCm39) missense probably damaging 1.00
R5448:Prpf40a UTSW 2 53,046,938 (GRCm39) missense possibly damaging 0.63
R5449:Prpf40a UTSW 2 53,046,938 (GRCm39) missense possibly damaging 0.63
R5450:Prpf40a UTSW 2 53,046,938 (GRCm39) missense possibly damaging 0.63
R5500:Prpf40a UTSW 2 53,035,296 (GRCm39) missense probably benign 0.03
R5637:Prpf40a UTSW 2 53,046,746 (GRCm39) missense possibly damaging 0.59
R6052:Prpf40a UTSW 2 53,049,293 (GRCm39) missense probably benign 0.41
R6149:Prpf40a UTSW 2 53,047,927 (GRCm39) missense probably benign 0.07
R6150:Prpf40a UTSW 2 53,047,927 (GRCm39) missense probably benign 0.07
R6151:Prpf40a UTSW 2 53,047,927 (GRCm39) missense probably benign 0.07
R6162:Prpf40a UTSW 2 53,049,317 (GRCm39) missense probably benign 0.01
R6199:Prpf40a UTSW 2 53,047,927 (GRCm39) missense probably benign 0.07
R6200:Prpf40a UTSW 2 53,047,927 (GRCm39) missense probably benign 0.07
R6207:Prpf40a UTSW 2 53,047,927 (GRCm39) missense probably benign 0.07
R6254:Prpf40a UTSW 2 53,047,927 (GRCm39) missense probably benign 0.07
R6266:Prpf40a UTSW 2 53,046,639 (GRCm39) missense probably benign 0.17
R6394:Prpf40a UTSW 2 53,034,890 (GRCm39) missense probably damaging 1.00
R6603:Prpf40a UTSW 2 53,042,975 (GRCm39) missense probably damaging 0.96
R6606:Prpf40a UTSW 2 53,041,763 (GRCm39) missense probably damaging 0.99
R6641:Prpf40a UTSW 2 53,031,638 (GRCm39) unclassified probably benign
R6929:Prpf40a UTSW 2 53,034,875 (GRCm39) missense possibly damaging 0.95
R7158:Prpf40a UTSW 2 53,042,565 (GRCm39) missense probably damaging 0.99
R7675:Prpf40a UTSW 2 53,035,648 (GRCm39) missense possibly damaging 0.89
R7750:Prpf40a UTSW 2 53,041,757 (GRCm39) missense probably damaging 1.00
R7893:Prpf40a UTSW 2 53,046,853 (GRCm39) missense probably benign 0.24
R8027:Prpf40a UTSW 2 53,081,150 (GRCm39) missense probably benign 0.01
R8817:Prpf40a UTSW 2 53,042,971 (GRCm39) missense probably damaging 0.99
R8829:Prpf40a UTSW 2 53,047,927 (GRCm39) missense probably benign 0.07
R8964:Prpf40a UTSW 2 53,035,906 (GRCm39) missense probably damaging 1.00
R9101:Prpf40a UTSW 2 53,035,255 (GRCm39) missense probably benign 0.07
R9411:Prpf40a UTSW 2 53,029,200 (GRCm39) missense unknown
R9699:Prpf40a UTSW 2 53,035,735 (GRCm39) missense probably benign 0.02
X0060:Prpf40a UTSW 2 53,035,676 (GRCm39) missense probably damaging 0.96
Z1176:Prpf40a UTSW 2 53,034,887 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTTGCTCTTCAGTTGATACAG -3'
(R):5'- TGTATTGAAATGACCAGTTCTCGTG -3'

Sequencing Primer
(F):5'- TATCTACAGCAGTAGCAACAATGG -3'
(R):5'- GAAATGACCAGTTCTCGTGTTCTC -3'
Posted On 2019-09-13