Incidental Mutation 'R7401:Fermt1'
ID 574149
Institutional Source Beutler Lab
Gene Symbol Fermt1
Ensembl Gene ENSMUSG00000027356
Gene Name fermitin family member 1
Synonyms Kindlin-1, 5830467P10Rik
MMRRC Submission 045483-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7401 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 132746309-132787826 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 132759479 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Leucine at position 426 (V426L)
Ref Sequence ENSEMBL: ENSMUSP00000047616 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038280]
AlphaFold P59113
PDB Structure Solution Structure of the N-terminal domain of kindlin-1 [SOLUTION NMR]
Structural and functional characterisation of the kindlin-1 pleckstrin homology domain [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000038280
AA Change: V426L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000047616
Gene: ENSMUSG00000027356
AA Change: V426L

DomainStartEndE-ValueType
Blast:B41 10 74 2e-16 BLAST
B41 91 570 1.39e-30 SMART
PH 370 475 2.81e-8 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the fermitin family, and contains a FERM domain and a pleckstrin homology domain. The encoded protein is involved in integrin signaling and linkage of the actin cytoskeleton to the extracellular matrix. Mutations in this gene have been linked to Kindler syndrome. [provided by RefSeq, Dec 2009]
PHENOTYPE: Mice homozygous for a null allele exhibit postnatal lethality within 5 days of birth, dehydration, detachment of colonic epithelial cells, and colonic inflammation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610318N02Rik A T 16: 16,936,268 (GRCm39) L152Q probably benign Het
Abcg3 A T 5: 105,114,640 (GRCm39) N292K probably damaging Het
Adamts3 T A 5: 89,855,309 (GRCm39) probably null Het
Adgrg7 T C 16: 56,562,781 (GRCm39) N519D probably benign Het
Adsl A G 15: 80,846,983 (GRCm39) H263R probably damaging Het
Ak9 A T 10: 41,299,000 (GRCm39) D1567V unknown Het
Bscl2 T C 19: 8,823,914 (GRCm39) F280L possibly damaging Het
Cacna1b T A 2: 24,569,306 (GRCm39) T873S probably benign Het
Cacna1c T C 6: 119,029,669 (GRCm39) probably null Het
Cast G T 13: 74,956,577 (GRCm39) A18E unknown Het
Cd207 A C 6: 83,654,830 (GRCm39) probably benign Het
Cd79b A G 11: 106,203,678 (GRCm39) S130P probably benign Het
Cfap52 A T 11: 67,840,459 (GRCm39) N157K probably benign Het
Cfap57 C T 4: 118,472,128 (GRCm39) V84I probably benign Het
Chaf1b G T 16: 93,681,268 (GRCm39) probably benign Het
Cntn1 A G 15: 92,215,870 (GRCm39) I968V probably benign Het
Cntn5 C T 9: 9,833,466 (GRCm39) V362I probably benign Het
Crem A G 18: 3,295,329 (GRCm39) S80P probably damaging Het
Csnk1g3 C T 18: 54,063,390 (GRCm39) T267I probably damaging Het
Cyth1 A T 11: 118,073,077 (GRCm39) N274K possibly damaging Het
Dicer1 C T 12: 104,678,537 (GRCm39) G594S probably benign Het
Enpp1 C T 10: 24,521,180 (GRCm39) C849Y probably damaging Het
Fam193a A G 5: 34,622,979 (GRCm39) E1189G possibly damaging Het
Fes A G 7: 80,028,524 (GRCm39) probably null Het
Gmeb1 C A 4: 131,953,085 (GRCm39) L560F probably damaging Het
Hace1 T C 10: 45,546,722 (GRCm39) L452P probably damaging Het
Hecw2 T A 1: 53,943,502 (GRCm39) H975L probably damaging Het
Idh2 GGTCCCAG GG 7: 79,748,077 (GRCm39) probably benign Het
Il1r2 T A 1: 40,162,370 (GRCm39) C338S probably damaging Het
Iqcn T C 8: 71,169,921 (GRCm39) I1337T probably benign Het
Kcnb1 T C 2: 167,030,204 (GRCm39) S114G probably damaging Het
Lce1c A T 3: 92,587,623 (GRCm39) T17S unknown Het
Lhfpl4 C A 6: 113,153,627 (GRCm39) L141F possibly damaging Het
Ms4a14 T C 19: 11,279,594 (GRCm39) E988G possibly damaging Het
Naip5 T C 13: 100,356,204 (GRCm39) Q1137R probably benign Het
Naip5 G T 13: 100,356,205 (GRCm39) Q1137K not run Het
Neurod1 T A 2: 79,285,290 (GRCm39) D31V probably benign Het
Neurod4 A G 10: 130,106,927 (GRCm39) C116R probably damaging Het
Nisch A G 14: 30,928,537 (GRCm39) V28A probably benign Het
Odad1 A C 7: 45,592,189 (GRCm39) Q323P probably damaging Het
Or4a72 A G 2: 89,405,449 (GRCm39) V207A probably benign Het
Or5d44 T G 2: 88,141,772 (GRCm39) M123L probably benign Het
Pabpc4l T A 3: 46,401,024 (GRCm39) R207W probably damaging Het
Pabpc4l A T 3: 46,400,687 (GRCm39) I319N probably damaging Het
Pcm1 G A 8: 41,762,568 (GRCm39) D1371N probably damaging Het
Peg10 G GGTC 6: 4,756,452 (GRCm39) probably benign Het
Plxnc1 C T 10: 94,706,867 (GRCm39) A557T probably benign Het
Prkdc T A 16: 15,466,602 (GRCm39) V58D probably damaging Het
Prpf40a A G 2: 53,046,959 (GRCm39) V259A probably benign Het
Psmd3 A T 11: 98,576,466 (GRCm39) T123S probably benign Het
Ptgr2 G T 12: 84,339,103 (GRCm39) probably benign Het
Ptprr A G 10: 115,884,141 (GRCm39) H66R probably benign Het
Rftn2 A G 1: 55,233,401 (GRCm39) probably null Het
Rsph14 T A 10: 74,865,628 (GRCm39) E70V possibly damaging Het
Slc24a5 G A 2: 124,930,111 (GRCm39) V471I probably benign Het
Sorbs1 G C 19: 40,365,244 (GRCm39) R180G probably benign Het
Spag9 A T 11: 93,988,515 (GRCm39) T862S probably benign Het
Ssbp2 T A 13: 91,839,002 (GRCm39) D291E probably benign Het
Supt5 T C 7: 28,023,197 (GRCm39) K329E probably damaging Het
Syne2 G T 12: 76,014,155 (GRCm39) K3115N probably damaging Het
Tars1 A T 15: 11,392,095 (GRCm39) L239* probably null Het
Tbxa2r T C 10: 81,168,625 (GRCm39) Y105H probably benign Het
Tesk1 T A 4: 43,445,743 (GRCm39) D265E probably damaging Het
Tril T C 6: 53,795,266 (GRCm39) D652G possibly damaging Het
Tsga10 T C 1: 37,873,268 (GRCm39) R204G probably null Het
Twnk A G 19: 45,000,219 (GRCm39) D645G probably benign Het
Umodl1 A T 17: 31,217,122 (GRCm39) D1118V probably damaging Het
Unc119 T C 11: 78,238,071 (GRCm39) I83T probably benign Het
Unc80 T C 1: 66,685,574 (GRCm39) W2233R possibly damaging Het
Vmn1r45 T A 6: 89,910,416 (GRCm39) T185S possibly damaging Het
Vmn2r111 G T 17: 22,790,067 (GRCm39) T313K possibly damaging Het
Wdr4 A G 17: 31,728,806 (GRCm39) L123S probably damaging Het
Zfpm2 A G 15: 40,966,386 (GRCm39) E957G possibly damaging Het
Other mutations in Fermt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02391:Fermt1 APN 2 132,783,871 (GRCm39) missense probably damaging 1.00
IGL02511:Fermt1 APN 2 132,775,086 (GRCm39) splice site probably benign
IGL02591:Fermt1 APN 2 132,776,786 (GRCm39) missense possibly damaging 0.89
IGL03107:Fermt1 APN 2 132,775,059 (GRCm39) missense probably damaging 1.00
R0691:Fermt1 UTSW 2 132,748,653 (GRCm39) missense probably damaging 0.99
R1386:Fermt1 UTSW 2 132,757,978 (GRCm39) missense probably damaging 0.99
R1468:Fermt1 UTSW 2 132,766,942 (GRCm39) missense probably benign 0.16
R1468:Fermt1 UTSW 2 132,766,942 (GRCm39) missense probably benign 0.16
R1474:Fermt1 UTSW 2 132,766,942 (GRCm39) missense probably benign 0.16
R1510:Fermt1 UTSW 2 132,766,942 (GRCm39) missense probably benign 0.16
R1558:Fermt1 UTSW 2 132,776,739 (GRCm39) critical splice donor site probably null
R1625:Fermt1 UTSW 2 132,764,751 (GRCm39) missense probably damaging 1.00
R1917:Fermt1 UTSW 2 132,764,762 (GRCm39) missense probably damaging 1.00
R2026:Fermt1 UTSW 2 132,760,445 (GRCm39) missense probably benign 0.11
R2264:Fermt1 UTSW 2 132,757,110 (GRCm39) critical splice donor site probably null
R2512:Fermt1 UTSW 2 132,781,438 (GRCm39) splice site probably null
R3765:Fermt1 UTSW 2 132,748,622 (GRCm39) missense possibly damaging 0.55
R4914:Fermt1 UTSW 2 132,748,760 (GRCm39) missense probably damaging 1.00
R5184:Fermt1 UTSW 2 132,783,883 (GRCm39) missense possibly damaging 0.50
R5259:Fermt1 UTSW 2 132,748,685 (GRCm39) missense probably damaging 0.99
R5303:Fermt1 UTSW 2 132,753,259 (GRCm39) splice site probably null
R5304:Fermt1 UTSW 2 132,783,986 (GRCm39) missense probably benign 0.00
R5404:Fermt1 UTSW 2 132,776,789 (GRCm39) missense possibly damaging 0.55
R5569:Fermt1 UTSW 2 132,757,123 (GRCm39) missense possibly damaging 0.89
R7146:Fermt1 UTSW 2 132,776,785 (GRCm39) missense probably benign 0.02
R7561:Fermt1 UTSW 2 132,758,008 (GRCm39) missense probably benign 0.02
R8518:Fermt1 UTSW 2 132,748,635 (GRCm39) missense probably benign 0.20
R8707:Fermt1 UTSW 2 132,766,881 (GRCm39) missense probably benign
R8896:Fermt1 UTSW 2 132,783,852 (GRCm39) splice site probably benign
R9502:Fermt1 UTSW 2 132,781,388 (GRCm39) missense probably benign 0.00
X0013:Fermt1 UTSW 2 132,760,506 (GRCm39) missense probably damaging 0.96
Z1176:Fermt1 UTSW 2 132,783,863 (GRCm39) missense probably benign
Z1176:Fermt1 UTSW 2 132,777,938 (GRCm39) missense probably benign 0.42
Z1176:Fermt1 UTSW 2 132,748,676 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCTGCTATTTATACAGTTCTATAGA -3'
(R):5'- CCATGCTGTTTATAAGCCTTGTT -3'

Sequencing Primer
(F):5'- CTATGTGAGTCCAGGGAATTGAACTC -3'
(R):5'- GCTGTTTATAAGCCTTGTTAGTCTTC -3'
Posted On 2019-09-13