Incidental Mutation 'R7401:Kcnb1'
ID 574150
Institutional Source Beutler Lab
Gene Symbol Kcnb1
Ensembl Gene ENSMUSG00000050556
Gene Name potassium voltage gated channel, Shab-related subfamily, member 1
Synonyms Shab, Kcr1-1, Kv2.1
MMRRC Submission 045483-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7401 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 166937889-167032075 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 167030204 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Glycine at position 114 (S114G)
Ref Sequence ENSEMBL: ENSMUSP00000057981 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059826] [ENSMUST00000088041] [ENSMUST00000207917]
AlphaFold Q03717
Predicted Effect probably damaging
Transcript: ENSMUST00000059826
AA Change: S114G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000057981
Gene: ENSMUSG00000050556
AA Change: S114G

DomainStartEndE-ValueType
BTB 31 140 1.3e-14 SMART
low complexity region 150 162 N/A INTRINSIC
Pfam:Ion_trans 188 424 2.4e-50 PFAM
Pfam:Ion_trans_2 332 418 1.2e-13 PFAM
Pfam:Kv2channel 467 618 5.4e-48 PFAM
low complexity region 698 706 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000088041
SMART Domains Protein: ENSMUSP00000085357
Gene: ENSMUSG00000017969

DomainStartEndE-ValueType
low complexity region 4 27 N/A INTRINSIC
Pfam:p450 31 496 1.9e-37 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000207917
AA Change: S114G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shab-related subfamily. This member is a delayed rectifier potassium channel and its activity is modulated by some other family members. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele show reduced fasting glucose levels, hyperinsulinemia, improved glucose tolerance, altered glucose-induced electrical activity of pancreatic beta cells, and enhanced insulin secretion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610318N02Rik A T 16: 16,936,268 (GRCm39) L152Q probably benign Het
Abcg3 A T 5: 105,114,640 (GRCm39) N292K probably damaging Het
Adamts3 T A 5: 89,855,309 (GRCm39) probably null Het
Adgrg7 T C 16: 56,562,781 (GRCm39) N519D probably benign Het
Adsl A G 15: 80,846,983 (GRCm39) H263R probably damaging Het
Ak9 A T 10: 41,299,000 (GRCm39) D1567V unknown Het
Bscl2 T C 19: 8,823,914 (GRCm39) F280L possibly damaging Het
Cacna1b T A 2: 24,569,306 (GRCm39) T873S probably benign Het
Cacna1c T C 6: 119,029,669 (GRCm39) probably null Het
Cast G T 13: 74,956,577 (GRCm39) A18E unknown Het
Cd207 A C 6: 83,654,830 (GRCm39) probably benign Het
Cd79b A G 11: 106,203,678 (GRCm39) S130P probably benign Het
Cfap52 A T 11: 67,840,459 (GRCm39) N157K probably benign Het
Cfap57 C T 4: 118,472,128 (GRCm39) V84I probably benign Het
Chaf1b G T 16: 93,681,268 (GRCm39) probably benign Het
Cntn1 A G 15: 92,215,870 (GRCm39) I968V probably benign Het
Cntn5 C T 9: 9,833,466 (GRCm39) V362I probably benign Het
Crem A G 18: 3,295,329 (GRCm39) S80P probably damaging Het
Csnk1g3 C T 18: 54,063,390 (GRCm39) T267I probably damaging Het
Cyth1 A T 11: 118,073,077 (GRCm39) N274K possibly damaging Het
Dicer1 C T 12: 104,678,537 (GRCm39) G594S probably benign Het
Enpp1 C T 10: 24,521,180 (GRCm39) C849Y probably damaging Het
Fam193a A G 5: 34,622,979 (GRCm39) E1189G possibly damaging Het
Fermt1 C A 2: 132,759,479 (GRCm39) V426L probably benign Het
Fes A G 7: 80,028,524 (GRCm39) probably null Het
Gmeb1 C A 4: 131,953,085 (GRCm39) L560F probably damaging Het
Hace1 T C 10: 45,546,722 (GRCm39) L452P probably damaging Het
Hecw2 T A 1: 53,943,502 (GRCm39) H975L probably damaging Het
Idh2 GGTCCCAG GG 7: 79,748,077 (GRCm39) probably benign Het
Il1r2 T A 1: 40,162,370 (GRCm39) C338S probably damaging Het
Iqcn T C 8: 71,169,921 (GRCm39) I1337T probably benign Het
Lce1c A T 3: 92,587,623 (GRCm39) T17S unknown Het
Lhfpl4 C A 6: 113,153,627 (GRCm39) L141F possibly damaging Het
Ms4a14 T C 19: 11,279,594 (GRCm39) E988G possibly damaging Het
Naip5 T C 13: 100,356,204 (GRCm39) Q1137R probably benign Het
Naip5 G T 13: 100,356,205 (GRCm39) Q1137K not run Het
Neurod1 T A 2: 79,285,290 (GRCm39) D31V probably benign Het
Neurod4 A G 10: 130,106,927 (GRCm39) C116R probably damaging Het
Nisch A G 14: 30,928,537 (GRCm39) V28A probably benign Het
Odad1 A C 7: 45,592,189 (GRCm39) Q323P probably damaging Het
Or4a72 A G 2: 89,405,449 (GRCm39) V207A probably benign Het
Or5d44 T G 2: 88,141,772 (GRCm39) M123L probably benign Het
Pabpc4l T A 3: 46,401,024 (GRCm39) R207W probably damaging Het
Pabpc4l A T 3: 46,400,687 (GRCm39) I319N probably damaging Het
Pcm1 G A 8: 41,762,568 (GRCm39) D1371N probably damaging Het
Peg10 G GGTC 6: 4,756,452 (GRCm39) probably benign Het
Plxnc1 C T 10: 94,706,867 (GRCm39) A557T probably benign Het
Prkdc T A 16: 15,466,602 (GRCm39) V58D probably damaging Het
Prpf40a A G 2: 53,046,959 (GRCm39) V259A probably benign Het
Psmd3 A T 11: 98,576,466 (GRCm39) T123S probably benign Het
Ptgr2 G T 12: 84,339,103 (GRCm39) probably benign Het
Ptprr A G 10: 115,884,141 (GRCm39) H66R probably benign Het
Rftn2 A G 1: 55,233,401 (GRCm39) probably null Het
Rsph14 T A 10: 74,865,628 (GRCm39) E70V possibly damaging Het
Slc24a5 G A 2: 124,930,111 (GRCm39) V471I probably benign Het
Sorbs1 G C 19: 40,365,244 (GRCm39) R180G probably benign Het
Spag9 A T 11: 93,988,515 (GRCm39) T862S probably benign Het
Ssbp2 T A 13: 91,839,002 (GRCm39) D291E probably benign Het
Supt5 T C 7: 28,023,197 (GRCm39) K329E probably damaging Het
Syne2 G T 12: 76,014,155 (GRCm39) K3115N probably damaging Het
Tars1 A T 15: 11,392,095 (GRCm39) L239* probably null Het
Tbxa2r T C 10: 81,168,625 (GRCm39) Y105H probably benign Het
Tesk1 T A 4: 43,445,743 (GRCm39) D265E probably damaging Het
Tril T C 6: 53,795,266 (GRCm39) D652G possibly damaging Het
Tsga10 T C 1: 37,873,268 (GRCm39) R204G probably null Het
Twnk A G 19: 45,000,219 (GRCm39) D645G probably benign Het
Umodl1 A T 17: 31,217,122 (GRCm39) D1118V probably damaging Het
Unc119 T C 11: 78,238,071 (GRCm39) I83T probably benign Het
Unc80 T C 1: 66,685,574 (GRCm39) W2233R possibly damaging Het
Vmn1r45 T A 6: 89,910,416 (GRCm39) T185S possibly damaging Het
Vmn2r111 G T 17: 22,790,067 (GRCm39) T313K possibly damaging Het
Wdr4 A G 17: 31,728,806 (GRCm39) L123S probably damaging Het
Zfpm2 A G 15: 40,966,386 (GRCm39) E957G possibly damaging Het
Other mutations in Kcnb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01593:Kcnb1 APN 2 166,948,127 (GRCm39) missense probably damaging 1.00
IGL02945:Kcnb1 APN 2 167,030,308 (GRCm39) missense probably benign 0.03
R0139:Kcnb1 UTSW 2 166,947,459 (GRCm39) missense possibly damaging 0.94
R0144:Kcnb1 UTSW 2 166,946,467 (GRCm39) missense probably damaging 1.00
R0238:Kcnb1 UTSW 2 166,946,889 (GRCm39) missense probably benign 0.04
R0238:Kcnb1 UTSW 2 166,946,889 (GRCm39) missense probably benign 0.04
R0848:Kcnb1 UTSW 2 166,948,187 (GRCm39) missense probably damaging 1.00
R2869:Kcnb1 UTSW 2 166,947,855 (GRCm39) missense probably damaging 1.00
R2869:Kcnb1 UTSW 2 166,947,855 (GRCm39) missense probably damaging 1.00
R3964:Kcnb1 UTSW 2 166,946,412 (GRCm39) missense probably damaging 1.00
R3966:Kcnb1 UTSW 2 166,946,412 (GRCm39) missense probably damaging 1.00
R4254:Kcnb1 UTSW 2 166,947,651 (GRCm39) missense probably damaging 1.00
R4418:Kcnb1 UTSW 2 166,947,595 (GRCm39) nonsense probably null
R4625:Kcnb1 UTSW 2 167,030,153 (GRCm39) missense probably damaging 1.00
R4949:Kcnb1 UTSW 2 166,947,521 (GRCm39) missense probably damaging 1.00
R5144:Kcnb1 UTSW 2 166,947,864 (GRCm39) missense probably damaging 1.00
R5249:Kcnb1 UTSW 2 166,947,103 (GRCm39) missense possibly damaging 0.95
R5849:Kcnb1 UTSW 2 166,947,946 (GRCm39) missense probably damaging 1.00
R5869:Kcnb1 UTSW 2 167,029,991 (GRCm39) missense probably benign 0.01
R6108:Kcnb1 UTSW 2 166,947,060 (GRCm39) missense probably damaging 1.00
R6636:Kcnb1 UTSW 2 166,947,774 (GRCm39) missense probably damaging 0.99
R6637:Kcnb1 UTSW 2 166,947,774 (GRCm39) missense probably damaging 0.99
R6880:Kcnb1 UTSW 2 166,947,727 (GRCm39) missense probably damaging 1.00
R7391:Kcnb1 UTSW 2 166,947,370 (GRCm39) missense probably damaging 1.00
R7651:Kcnb1 UTSW 2 167,030,281 (GRCm39) missense probably damaging 1.00
R7744:Kcnb1 UTSW 2 167,030,251 (GRCm39) missense probably damaging 1.00
R7825:Kcnb1 UTSW 2 166,947,892 (GRCm39) missense probably damaging 1.00
R7848:Kcnb1 UTSW 2 166,948,188 (GRCm39) missense probably damaging 1.00
R7934:Kcnb1 UTSW 2 166,946,536 (GRCm39) missense probably benign 0.03
R8215:Kcnb1 UTSW 2 166,946,361 (GRCm39) missense probably benign 0.43
R8241:Kcnb1 UTSW 2 166,948,117 (GRCm39) missense probably damaging 1.00
R8388:Kcnb1 UTSW 2 166,947,217 (GRCm39) missense probably benign
R8553:Kcnb1 UTSW 2 166,946,531 (GRCm39) missense possibly damaging 0.67
R9353:Kcnb1 UTSW 2 166,947,007 (GRCm39) missense probably benign
R9622:Kcnb1 UTSW 2 167,030,161 (GRCm39) missense probably damaging 1.00
Z1088:Kcnb1 UTSW 2 167,029,981 (GRCm39) missense probably benign 0.38
Z1176:Kcnb1 UTSW 2 167,030,322 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGCAGGTCCCAAAGTTTCTTCC -3'
(R):5'- TCACAGTACGGTTCGCTGAC -3'

Sequencing Primer
(F):5'- CTCTTCTCAGCACAGCACG -3'
(R):5'- GCATGACGAAGCATGGCTC -3'
Posted On 2019-09-13