Incidental Mutation 'R7401:Fam193a'
ID 574157
Institutional Source Beutler Lab
Gene Symbol Fam193a
Ensembl Gene ENSMUSG00000037210
Gene Name family with sequence similarity 193, member A
Synonyms
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_001243123.1; MGI:2447768

Is this an essential gene? Probably non essential (E-score: 0.162) question?
Stock # R7401 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 34369933-34486456 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 34465635 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1189 (E1189G)
Ref Sequence ENSEMBL: ENSMUSP00000138082 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094867] [ENSMUST00000180376] [ENSMUST00000181379]
AlphaFold Q8CGI1
Predicted Effect probably benign
Transcript: ENSMUST00000094867
AA Change: E903G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000092463
Gene: ENSMUSG00000037210
AA Change: E903G

DomainStartEndE-ValueType
coiled coil region 113 141 N/A INTRINSIC
low complexity region 258 270 N/A INTRINSIC
low complexity region 347 368 N/A INTRINSIC
low complexity region 584 593 N/A INTRINSIC
low complexity region 608 643 N/A INTRINSIC
low complexity region 676 691 N/A INTRINSIC
low complexity region 763 785 N/A INTRINSIC
low complexity region 819 832 N/A INTRINSIC
coiled coil region 879 946 N/A INTRINSIC
low complexity region 980 993 N/A INTRINSIC
low complexity region 1052 1063 N/A INTRINSIC
low complexity region 1155 1166 N/A INTRINSIC
Pfam:FAM193_C 1174 1230 3.5e-33 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000180376
AA Change: E1189G

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000138082
Gene: ENSMUSG00000037210
AA Change: E1189G

DomainStartEndE-ValueType
SCOP:d1gvp__ 70 93 4e-3 SMART
coiled coil region 399 427 N/A INTRINSIC
low complexity region 544 556 N/A INTRINSIC
low complexity region 633 654 N/A INTRINSIC
low complexity region 870 879 N/A INTRINSIC
low complexity region 894 929 N/A INTRINSIC
low complexity region 962 977 N/A INTRINSIC
low complexity region 1049 1071 N/A INTRINSIC
low complexity region 1105 1118 N/A INTRINSIC
coiled coil region 1165 1232 N/A INTRINSIC
low complexity region 1266 1279 N/A INTRINSIC
low complexity region 1338 1349 N/A INTRINSIC
low complexity region 1441 1452 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000181379
SMART Domains Protein: ENSMUSP00000137979
Gene: ENSMUSG00000037210

DomainStartEndE-ValueType
low complexity region 88 99 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI

All alleles(19) : Gene trapped(19)

Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610318N02Rik A T 16: 17,118,404 L152Q probably benign Het
Abcg3 A T 5: 104,966,774 N292K probably damaging Het
Adamts3 T A 5: 89,707,450 probably null Het
Adgrg7 T C 16: 56,742,418 N519D probably benign Het
Adsl A G 15: 80,962,782 H263R probably damaging Het
Ak9 A T 10: 41,423,004 D1567V unknown Het
Bscl2 T C 19: 8,846,550 F280L possibly damaging Het
Cacna1b T A 2: 24,679,294 T873S probably benign Het
Cacna1c T C 6: 119,052,708 probably null Het
Cast G T 13: 74,808,458 A18E unknown Het
Ccdc114 A C 7: 45,942,765 Q323P probably damaging Het
Cd207 A C 6: 83,677,848 probably benign Het
Cd79b A G 11: 106,312,852 S130P probably benign Het
Cfap52 A T 11: 67,949,633 N157K probably benign Het
Cfap57 C T 4: 118,614,931 V84I probably benign Het
Chaf1b G T 16: 93,884,380 probably benign Het
Cntn1 A G 15: 92,317,989 I968V probably benign Het
Cntn5 C T 9: 9,833,461 V362I probably benign Het
Crem A G 18: 3,295,329 S80P probably damaging Het
Csnk1g3 C T 18: 53,930,318 T267I probably damaging Het
Cyth1 A T 11: 118,182,251 N274K possibly damaging Het
Dicer1 C T 12: 104,712,278 G594S probably benign Het
Enpp1 C T 10: 24,645,282 C849Y probably damaging Het
Fermt1 C A 2: 132,917,559 V426L probably benign Het
Fes A G 7: 80,378,776 probably null Het
Gm16486 T C 8: 70,717,272 I1337T probably benign Het
Gmeb1 C A 4: 132,225,774 L560F probably damaging Het
Hace1 T C 10: 45,670,626 L452P probably damaging Het
Hecw2 T A 1: 53,904,343 H975L probably damaging Het
Idh2 GGTCCCAG GG 7: 80,098,329 probably benign Het
Il1r2 T A 1: 40,123,210 C338S probably damaging Het
Kcnb1 T C 2: 167,188,284 S114G probably damaging Het
Lce1c A T 3: 92,680,316 T17S unknown Het
Lhfpl4 C A 6: 113,176,666 L141F possibly damaging Het
Ms4a14 T C 19: 11,302,230 E988G possibly damaging Het
Naip5 T C 13: 100,219,696 Q1137R probably benign Het
Naip5 G T 13: 100,219,697 Q1137K not run Het
Neurod1 T A 2: 79,454,946 D31V probably benign Het
Neurod4 A G 10: 130,271,058 C116R probably damaging Het
Nisch A G 14: 31,206,580 V28A probably benign Het
Olfr1174-ps T G 2: 88,311,428 M123L probably benign Het
Olfr1245 A G 2: 89,575,105 V207A probably benign Het
Pabpc4l A T 3: 46,446,252 I319N probably damaging Het
Pabpc4l T A 3: 46,446,589 R207W probably damaging Het
Pcm1 G A 8: 41,309,531 D1371N probably damaging Het
Peg10 G GGTC 6: 4,756,452 probably benign Het
Plxnc1 C T 10: 94,871,005 A557T probably benign Het
Prkdc T A 16: 15,648,738 V58D probably damaging Het
Prpf40a A G 2: 53,156,947 V259A probably benign Het
Psmd3 A T 11: 98,685,640 T123S probably benign Het
Ptgr2 G T 12: 84,292,329 probably benign Het
Ptprr A G 10: 116,048,236 H66R probably benign Het
Rftn2 A G 1: 55,194,242 probably null Het
Rsph14 T A 10: 75,029,796 E70V possibly damaging Het
Slc24a5 G A 2: 125,088,191 V471I probably benign Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Spag9 A T 11: 94,097,689 T862S probably benign Het
Ssbp2 T A 13: 91,690,883 D291E probably benign Het
Supt5 T C 7: 28,323,772 K329E probably damaging Het
Syne2 G T 12: 75,967,381 K3115N probably damaging Het
Tars A T 15: 11,392,009 L239* probably null Het
Tbxa2r T C 10: 81,332,791 Y105H probably benign Het
Tesk1 T A 4: 43,445,743 D265E probably damaging Het
Tril T C 6: 53,818,281 D652G possibly damaging Het
Tsga10 T C 1: 37,834,187 R204G probably null Het
Twnk A G 19: 45,011,780 D645G probably benign Het
Umodl1 A T 17: 30,998,148 D1118V probably damaging Het
Unc119 T C 11: 78,347,245 I83T probably benign Het
Unc80 T C 1: 66,646,415 W2233R possibly damaging Het
Vmn1r45 T A 6: 89,933,434 T185S possibly damaging Het
Vmn2r111 G T 17: 22,571,086 T313K possibly damaging Het
Wdr4 A G 17: 31,509,832 L123S probably damaging Het
Zfpm2 A G 15: 41,102,990 E957G possibly damaging Het
Other mutations in Fam193a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01981:Fam193a APN 5 34431193 missense probably damaging 0.99
IGL02111:Fam193a APN 5 34410657 missense possibly damaging 0.72
IGL02139:Fam193a APN 5 34444737 missense probably benign 0.12
IGL02218:Fam193a APN 5 34443588 missense possibly damaging 0.68
BB010:Fam193a UTSW 5 34466195 missense possibly damaging 0.53
BB020:Fam193a UTSW 5 34466195 missense possibly damaging 0.53
P0017:Fam193a UTSW 5 34440463 missense probably damaging 1.00
PIT4418001:Fam193a UTSW 5 34440535 missense probably damaging 0.97
R0172:Fam193a UTSW 5 34465613 missense probably damaging 0.97
R0413:Fam193a UTSW 5 34466208 missense possibly damaging 0.83
R0512:Fam193a UTSW 5 34426391 missense probably damaging 1.00
R0735:Fam193a UTSW 5 34439378 missense possibly damaging 0.85
R0764:Fam193a UTSW 5 34443341 missense probably damaging 0.99
R0904:Fam193a UTSW 5 34462143 missense probably damaging 1.00
R1756:Fam193a UTSW 5 34466292 missense possibly damaging 0.91
R1765:Fam193a UTSW 5 34436497 missense probably damaging 0.99
R1766:Fam193a UTSW 5 34462131 missense probably damaging 0.99
R1845:Fam193a UTSW 5 34443372 missense possibly damaging 0.91
R2051:Fam193a UTSW 5 34462150 missense probably benign 0.19
R2483:Fam193a UTSW 5 34465758 missense possibly damaging 0.96
R3014:Fam193a UTSW 5 34465672 missense probably benign 0.33
R4523:Fam193a UTSW 5 34443371 missense probably benign 0.07
R4723:Fam193a UTSW 5 34420786 missense probably benign 0.04
R4823:Fam193a UTSW 5 34459028 missense probably damaging 1.00
R4826:Fam193a UTSW 5 34436531 missense probably damaging 1.00
R4863:Fam193a UTSW 5 34466205 missense possibly damaging 0.86
R5331:Fam193a UTSW 5 34465571 splice site probably null
R5364:Fam193a UTSW 5 34466253 missense probably benign 0.01
R5564:Fam193a UTSW 5 34420855 missense probably damaging 0.98
R5580:Fam193a UTSW 5 34420788 missense probably benign 0.33
R5784:Fam193a UTSW 5 34466223 missense probably damaging 0.99
R5933:Fam193a UTSW 5 34465680 missense probably damaging 0.98
R5949:Fam193a UTSW 5 34440472 missense possibly damaging 0.82
R6106:Fam193a UTSW 5 34459030 missense possibly damaging 0.67
R6181:Fam193a UTSW 5 34443540 splice site probably null
R7095:Fam193a UTSW 5 34458034 missense probably damaging 0.99
R7109:Fam193a UTSW 5 34465821 missense possibly damaging 0.86
R7344:Fam193a UTSW 5 34485730 missense possibly damaging 0.71
R7453:Fam193a UTSW 5 34464116 missense possibly damaging 0.72
R7456:Fam193a UTSW 5 34420788 missense possibly damaging 0.86
R7648:Fam193a UTSW 5 34431182 missense probably damaging 0.99
R7768:Fam193a UTSW 5 34465791 missense possibly damaging 0.85
R7783:Fam193a UTSW 5 34431180 missense probably damaging 0.99
R7818:Fam193a UTSW 5 34465653 missense possibly damaging 0.72
R7852:Fam193a UTSW 5 34410817 missense probably benign 0.01
R7853:Fam193a UTSW 5 34440129 missense probably benign 0.12
R7894:Fam193a UTSW 5 34440533 missense possibly damaging 0.92
R7933:Fam193a UTSW 5 34466195 missense possibly damaging 0.53
R7957:Fam193a UTSW 5 34462086 missense probably damaging 1.00
R8191:Fam193a UTSW 5 34440573 missense probably damaging 0.96
R8281:Fam193a UTSW 5 34443436 missense unknown
R8554:Fam193a UTSW 5 34475771 missense probably benign 0.05
R8743:Fam193a UTSW 5 34420157 critical splice donor site probably null
R8821:Fam193a UTSW 5 34459030 missense probably benign 0.01
R8831:Fam193a UTSW 5 34459030 missense probably benign 0.01
R8896:Fam193a UTSW 5 34426484 missense probably benign 0.03
R8943:Fam193a UTSW 5 34440452 missense probably benign 0.01
R9026:Fam193a UTSW 5 34459192 missense possibly damaging 0.91
R9182:Fam193a UTSW 5 34466017 missense possibly damaging 0.72
R9210:Fam193a UTSW 5 34440137 missense probably benign 0.01
R9212:Fam193a UTSW 5 34440137 missense probably benign 0.01
R9291:Fam193a UTSW 5 34436491 missense probably damaging 1.00
R9515:Fam193a UTSW 5 34458027 missense possibly damaging 0.86
Z1088:Fam193a UTSW 5 34420895 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGTAGGTACATTTGTTACTGCCTC -3'
(R):5'- AGCAAGCATGTCCAACTTGG -3'

Sequencing Primer
(F):5'- CTTGGGGGATCAAATTCAACTCAC -3'
(R):5'- GGAACAGTCTTTACTTGGCCGATC -3'
Posted On 2019-09-13