Incidental Mutation 'R7401:Adamts3'
ID574158
Institutional Source Beutler Lab
Gene Symbol Adamts3
Ensembl Gene ENSMUSG00000043635
Gene Namea disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 3
Synonyms6330442E02Rik, 1100001H14Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7401 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location89677087-89883334 bp(-) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) T to A at 89707450 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000132219 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061427] [ENSMUST00000163159]
Predicted Effect probably null
Transcript: ENSMUST00000061427
SMART Domains Protein: ENSMUSP00000058552
Gene: ENSMUSG00000043635

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Pep_M12B_propep 42 201 5.1e-40 PFAM
Pfam:Reprolysin_5 254 439 5.4e-15 PFAM
Pfam:Reprolysin_4 256 454 1.9e-10 PFAM
Pfam:Reprolysin 257 460 3.6e-22 PFAM
Pfam:Reprolysin_2 274 451 7.7e-13 PFAM
Pfam:Reprolysin_3 278 409 1.5e-12 PFAM
TSP1 554 606 1.26e-15 SMART
Pfam:ADAM_spacer1 713 827 3e-34 PFAM
TSP1 848 905 4.35e-2 SMART
TSP1 908 967 4.95e-2 SMART
TSP1 969 1016 6.58e-5 SMART
low complexity region 1114 1128 N/A INTRINSIC
low complexity region 1157 1177 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000163159
SMART Domains Protein: ENSMUSP00000132219
Gene: ENSMUSG00000043635

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Pep_M12B_propep 43 201 1.5e-40 PFAM
Pfam:Reprolysin_5 254 439 2.2e-15 PFAM
Pfam:Reprolysin_4 256 454 7.7e-11 PFAM
Pfam:Reprolysin 257 460 3.7e-21 PFAM
Pfam:Reprolysin_2 274 451 4.3e-14 PFAM
Pfam:Reprolysin_3 278 409 1.3e-12 PFAM
TSP1 554 606 1.26e-15 SMART
Pfam:ADAM_spacer1 713 828 3.6e-28 PFAM
TSP1 849 906 4.35e-2 SMART
TSP1 909 968 4.95e-2 SMART
TSP1 970 1017 6.58e-5 SMART
low complexity region 1115 1129 N/A INTRINSIC
low complexity region 1158 1178 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. Members of the family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The encoded preproprotein is proteolytically processed to generate the mature protease. This protease, a member of the procollagen aminopropeptidase subfamily of proteins, may play a role in the processing of type II fibrillar collagen in articular cartilage. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610318N02Rik A T 16: 17,118,404 L152Q probably benign Het
Abcg3 A T 5: 104,966,774 N292K probably damaging Het
Adgrg7 T C 16: 56,742,418 N519D probably benign Het
Adsl A G 15: 80,962,782 H263R probably damaging Het
Ak9 A T 10: 41,423,004 D1567V unknown Het
Bscl2 T C 19: 8,846,550 F280L possibly damaging Het
Cacna1b T A 2: 24,679,294 T873S probably benign Het
Cacna1c T C 6: 119,052,708 probably null Het
Cast G T 13: 74,808,458 A18E unknown Het
Ccdc114 A C 7: 45,942,765 Q323P probably damaging Het
Cd207 A C 6: 83,677,848 probably benign Het
Cd79b A G 11: 106,312,852 S130P probably benign Het
Cfap52 A T 11: 67,949,633 N157K probably benign Het
Cfap57 C T 4: 118,614,931 V84I not run Het
Chaf1b G T 16: 93,884,380 probably benign Het
Cntn1 A G 15: 92,317,989 I968V probably benign Het
Cntn5 C T 9: 9,833,461 V362I probably benign Het
Crem A G 18: 3,295,329 S80P probably damaging Het
Csnk1g3 C T 18: 53,930,318 T267I probably damaging Het
Cyth1 A T 11: 118,182,251 N274K possibly damaging Het
Dicer1 C T 12: 104,712,278 G594S probably benign Het
Enpp1 C T 10: 24,645,282 C849Y probably damaging Het
Fam193a A G 5: 34,465,635 E1189G possibly damaging Het
Fermt1 C A 2: 132,917,559 V426L probably benign Het
Fes A G 7: 80,378,776 probably null Het
Gm16486 T C 8: 70,717,272 I1337T probably benign Het
Gmeb1 C A 4: 132,225,774 L560F probably damaging Het
Hace1 T C 10: 45,670,626 L452P probably damaging Het
Hecw2 T A 1: 53,904,343 H975L probably damaging Het
Idh2 GGTCCCAG GG 7: 80,098,329 probably benign Het
Il1r2 T A 1: 40,123,210 C338S probably damaging Het
Kcnb1 T C 2: 167,188,284 S114G probably damaging Het
Lce1c A T 3: 92,680,316 T17S unknown Het
Lhfpl4 C A 6: 113,176,666 L141F possibly damaging Het
Ms4a14 T C 19: 11,302,230 E988G possibly damaging Het
Naip5 T C 13: 100,219,696 Q1137R probably benign Het
Naip5 G T 13: 100,219,697 Q1137K not run Het
Neurod1 T A 2: 79,454,946 D31V probably benign Het
Neurod4 A G 10: 130,271,058 C116R probably damaging Het
Nisch A G 14: 31,206,580 V28A probably benign Het
Olfr1174-ps T G 2: 88,311,428 M123L probably benign Het
Olfr1245 A G 2: 89,575,105 V207A probably benign Het
Pabpc4l A T 3: 46,446,252 I319N probably damaging Het
Pabpc4l T A 3: 46,446,589 R207W probably damaging Het
Pcm1 G A 8: 41,309,531 D1371N probably damaging Het
Peg10 G GGTC 6: 4,756,452 probably benign Het
Plxnc1 C T 10: 94,871,005 A557T probably benign Het
Prkdc T A 16: 15,648,738 V58D probably damaging Het
Prpf40a A G 2: 53,156,947 V259A probably benign Het
Psmd3 A T 11: 98,685,640 T123S probably benign Het
Ptgr2 G T 12: 84,292,329 probably benign Het
Ptprr A G 10: 116,048,236 H66R probably benign Het
Rftn2 A G 1: 55,194,242 probably null Het
Rsph14 T A 10: 75,029,796 E70V possibly damaging Het
Slc24a5 G A 2: 125,088,191 V471I probably benign Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Spag9 A T 11: 94,097,689 T862S probably benign Het
Ssbp2 T A 13: 91,690,883 D291E probably benign Het
Supt5 T C 7: 28,323,772 K329E probably damaging Het
Syne2 G T 12: 75,967,381 K3115N probably damaging Het
Tars A T 15: 11,392,009 L239* probably null Het
Tbxa2r T C 10: 81,332,791 Y105H probably benign Het
Tesk1 T A 4: 43,445,743 D265E probably damaging Het
Tril T C 6: 53,818,281 D652G possibly damaging Het
Tsga10 T C 1: 37,834,187 R204G probably null Het
Twnk A G 19: 45,011,780 D645G probably benign Het
Umodl1 A T 17: 30,998,148 D1118V probably damaging Het
Unc119 T C 11: 78,347,245 I83T probably benign Het
Unc80 T C 1: 66,646,415 W2233R possibly damaging Het
Vmn1r45 T A 6: 89,933,434 T185S possibly damaging Het
Vmn2r111 G T 17: 22,571,086 T313K possibly damaging Het
Wdr4 A G 17: 31,509,832 L123S probably damaging Het
Zfpm2 A G 15: 41,102,990 E957G possibly damaging Het
Other mutations in Adamts3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Adamts3 APN 5 89861325 missense probably damaging 1.00
IGL00340:Adamts3 APN 5 89701666 missense probably damaging 1.00
IGL00923:Adamts3 APN 5 89684376 missense probably benign 0.06
IGL01420:Adamts3 APN 5 89703057 missense possibly damaging 0.57
IGL01522:Adamts3 APN 5 89702943 missense probably benign 0.14
IGL01676:Adamts3 APN 5 89677754 missense probably benign 0.00
IGL01676:Adamts3 APN 5 89881543 missense possibly damaging 0.54
IGL01678:Adamts3 APN 5 89707856 missense probably damaging 1.00
IGL01936:Adamts3 APN 5 89861423 missense probably benign 0.00
IGL01956:Adamts3 APN 5 89677911 missense probably damaging 0.99
IGL02342:Adamts3 APN 5 89691473 splice site probably null
IGL02415:Adamts3 APN 5 89706647 splice site probably null
IGL03261:Adamts3 APN 5 89882897 utr 5 prime probably benign
IGL03301:Adamts3 APN 5 89707404 missense probably damaging 1.00
R0041:Adamts3 UTSW 5 89684467 missense probably benign
R0079:Adamts3 UTSW 5 89693053 missense probably benign 0.00
R0096:Adamts3 UTSW 5 89701717 nonsense probably null
R0096:Adamts3 UTSW 5 89701717 nonsense probably null
R0477:Adamts3 UTSW 5 89684507 missense probably benign
R0605:Adamts3 UTSW 5 89861475 missense possibly damaging 0.96
R1036:Adamts3 UTSW 5 89696093 splice site probably benign
R1462:Adamts3 UTSW 5 89861349 missense probably benign 0.17
R1462:Adamts3 UTSW 5 89861349 missense probably benign 0.17
R1621:Adamts3 UTSW 5 89721701 missense probably damaging 1.00
R1799:Adamts3 UTSW 5 89775421 missense probably benign 0.00
R2163:Adamts3 UTSW 5 89708718 missense probably damaging 0.99
R2412:Adamts3 UTSW 5 89701771 missense probably damaging 0.99
R2420:Adamts3 UTSW 5 89683175 missense probably damaging 0.97
R2421:Adamts3 UTSW 5 89683175 missense probably damaging 0.97
R2422:Adamts3 UTSW 5 89683175 missense probably damaging 0.97
R2921:Adamts3 UTSW 5 89861534 missense possibly damaging 0.90
R2922:Adamts3 UTSW 5 89861534 missense possibly damaging 0.90
R2923:Adamts3 UTSW 5 89861534 missense possibly damaging 0.90
R3402:Adamts3 UTSW 5 89701733 missense probably benign 0.04
R3431:Adamts3 UTSW 5 89707453 splice site probably benign
R3432:Adamts3 UTSW 5 89707453 splice site probably benign
R3813:Adamts3 UTSW 5 89677926 missense possibly damaging 0.67
R3816:Adamts3 UTSW 5 89705264 missense probably damaging 0.99
R3905:Adamts3 UTSW 5 89861355 missense probably damaging 1.00
R3906:Adamts3 UTSW 5 89861355 missense probably damaging 1.00
R3907:Adamts3 UTSW 5 89861355 missense probably damaging 1.00
R3908:Adamts3 UTSW 5 89861355 missense probably damaging 1.00
R4557:Adamts3 UTSW 5 89700487 missense probably benign 0.03
R4684:Adamts3 UTSW 5 89703007 missense probably damaging 0.98
R4844:Adamts3 UTSW 5 89677816 missense probably damaging 0.99
R4925:Adamts3 UTSW 5 89684323 missense probably benign 0.01
R5097:Adamts3 UTSW 5 89693050 missense probably damaging 0.97
R5100:Adamts3 UTSW 5 89708643 missense probably damaging 1.00
R5237:Adamts3 UTSW 5 89775377 missense probably benign
R5265:Adamts3 UTSW 5 89861552 missense possibly damaging 0.91
R5322:Adamts3 UTSW 5 89707300 splice site probably null
R5413:Adamts3 UTSW 5 89708767 missense probably damaging 1.00
R5459:Adamts3 UTSW 5 89691473 splice site probably null
R5738:Adamts3 UTSW 5 89708668 missense probably damaging 1.00
R5979:Adamts3 UTSW 5 89861669 missense probably damaging 0.96
R5992:Adamts3 UTSW 5 89691335 missense probably damaging 1.00
R6364:Adamts3 UTSW 5 89721814 missense possibly damaging 0.92
R6572:Adamts3 UTSW 5 89861609 missense possibly damaging 0.87
R7098:Adamts3 UTSW 5 89861495 missense probably damaging 1.00
R7172:Adamts3 UTSW 5 89883001 start gained probably benign
R7263:Adamts3 UTSW 5 89677742 missense probably benign 0.03
R7599:Adamts3 UTSW 5 89861397 missense probably benign 0.00
R7829:Adamts3 UTSW 5 89861490 missense probably damaging 1.00
R7835:Adamts3 UTSW 5 89700440 missense possibly damaging 0.70
R7892:Adamts3 UTSW 5 89861429 missense probably benign 0.10
R7918:Adamts3 UTSW 5 89700440 missense possibly damaging 0.70
R7975:Adamts3 UTSW 5 89861429 missense probably benign 0.10
R8021:Adamts3 UTSW 5 89683184 missense possibly damaging 0.47
X0064:Adamts3 UTSW 5 89703042 missense possibly damaging 0.75
Z1088:Adamts3 UTSW 5 89684449 missense probably damaging 0.99
Z1176:Adamts3 UTSW 5 89775351 missense not run
Z1177:Adamts3 UTSW 5 89707864 nonsense probably null
Z1177:Adamts3 UTSW 5 89775351 missense not run
Predicted Primers PCR Primer
(F):5'- TGTGTAGCCTATGCAGCAGG -3'
(R):5'- ATGAGTAACTCTGTTTGGCTGAGC -3'

Sequencing Primer
(F):5'- TGCAGCAGGGCATGACATG -3'
(R):5'- TACCTGTGCTGTGCCACTGATG -3'
Posted On2019-09-13