Incidental Mutation 'R7401:Peg10'
ID 574160
Institutional Source Beutler Lab
Gene Symbol Peg10
Ensembl Gene ENSMUSG00000092035
Gene Name paternally expressed 10
Synonyms MEF3L, MyEF-3 like, Rtl2, Mar2, MyEF-3, HB-1, Edr, Mart2
MMRRC Submission 045483-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7401 (G1)
Quality Score 135.467
Status Not validated
Chromosome 6
Chromosomal Location 4747306-4760517 bp(+) (GRCm39)
Type of Mutation small insertion (1 aa in frame mutation)
DNA Base Change (assembly) G to GGTC at 4756452 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000135076 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166678] [ENSMUST00000176204] [ENSMUST00000176551]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000166678
SMART Domains Protein: ENSMUSP00000127306
Gene: ENSMUSG00000092035

DomainStartEndE-ValueType
low complexity region 11 26 N/A INTRINSIC
low complexity region 34 50 N/A INTRINSIC
low complexity region 80 107 N/A INTRINSIC
Pfam:DUF4939 130 220 6.1e-17 PFAM
Pfam:Retrotrans_gag 174 267 2.9e-20 PFAM
low complexity region 334 342 N/A INTRINSIC
ZnF_C2HC 345 361 3.34e-2 SMART
low complexity region 368 379 N/A INTRINSIC
low complexity region 541 610 N/A INTRINSIC
low complexity region 621 660 N/A INTRINSIC
low complexity region 663 785 N/A INTRINSIC
Blast:SERPIN 798 910 1e-5 BLAST
low complexity region 923 936 N/A INTRINSIC
low complexity region 972 998 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176204
SMART Domains Protein: ENSMUSP00000134963
Gene: ENSMUSG00000092035

DomainStartEndE-ValueType
low complexity region 11 26 N/A INTRINSIC
low complexity region 34 50 N/A INTRINSIC
low complexity region 80 107 N/A INTRINSIC
Pfam:Retrotrans_gag 174 267 1.3e-20 PFAM
low complexity region 334 342 N/A INTRINSIC
ZnF_C2HC 345 361 3.34e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176551
SMART Domains Protein: ENSMUSP00000135076
Gene: ENSMUSG00000092035

DomainStartEndE-ValueType
low complexity region 173 242 N/A INTRINSIC
low complexity region 253 292 N/A INTRINSIC
low complexity region 295 417 N/A INTRINSIC
Blast:SERPIN 430 542 6e-6 BLAST
low complexity region 555 568 N/A INTRINSIC
low complexity region 604 630 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: This is a paternally expressed imprinted gene that is thought to have been derived from the Ty3/Gypsy family of retrotransposons. It contains two overlapping open reading frames, RF1 and RF2, and expresses two proteins: a shorter, gag-like protein (with a CCHC-type zinc finger domain) from RF1; and a longer, gag/pol-like fusion protein (with an additional aspartic protease motif) from RF1/RF2 by -1 translational frameshifting (-1 FS). While -1 FS has been observed in RNA viruses and transposons in both prokaryotes and eukaryotes, this gene represents the first example of -1 FS in a eukaryotic cellular gene. This gene is highly conserved across mammalian species and retains the heptanucleotide (GGGAAAC) and pseudoknot elements required for -1 FS. It is expressed in adult and embryonic tissues (most notably in placenta) and reported to have a role in cell proliferation, differentiation, apoptosis and cancer development. Knockout mice lacking this gene showed early embryonic lethality with placental defects, indicating the importance of this gene in embryonic development. [provided by RefSeq, Oct 2014]
PHENOTYPE: Heterozygous mice with a paternally inherited null allele display embryonic lethality during organogenesis with abnormal placental development. Heterozygous mice with a maternally inherited null allele are viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610318N02Rik A T 16: 16,936,268 (GRCm39) L152Q probably benign Het
Abcg3 A T 5: 105,114,640 (GRCm39) N292K probably damaging Het
Adamts3 T A 5: 89,855,309 (GRCm39) probably null Het
Adgrg7 T C 16: 56,562,781 (GRCm39) N519D probably benign Het
Adsl A G 15: 80,846,983 (GRCm39) H263R probably damaging Het
Ak9 A T 10: 41,299,000 (GRCm39) D1567V unknown Het
Bscl2 T C 19: 8,823,914 (GRCm39) F280L possibly damaging Het
Cacna1b T A 2: 24,569,306 (GRCm39) T873S probably benign Het
Cacna1c T C 6: 119,029,669 (GRCm39) probably null Het
Cast G T 13: 74,956,577 (GRCm39) A18E unknown Het
Cd207 A C 6: 83,654,830 (GRCm39) probably benign Het
Cd79b A G 11: 106,203,678 (GRCm39) S130P probably benign Het
Cfap52 A T 11: 67,840,459 (GRCm39) N157K probably benign Het
Cfap57 C T 4: 118,472,128 (GRCm39) V84I probably benign Het
Chaf1b G T 16: 93,681,268 (GRCm39) probably benign Het
Cntn1 A G 15: 92,215,870 (GRCm39) I968V probably benign Het
Cntn5 C T 9: 9,833,466 (GRCm39) V362I probably benign Het
Crem A G 18: 3,295,329 (GRCm39) S80P probably damaging Het
Csnk1g3 C T 18: 54,063,390 (GRCm39) T267I probably damaging Het
Cyth1 A T 11: 118,073,077 (GRCm39) N274K possibly damaging Het
Dicer1 C T 12: 104,678,537 (GRCm39) G594S probably benign Het
Enpp1 C T 10: 24,521,180 (GRCm39) C849Y probably damaging Het
Fam193a A G 5: 34,622,979 (GRCm39) E1189G possibly damaging Het
Fermt1 C A 2: 132,759,479 (GRCm39) V426L probably benign Het
Fes A G 7: 80,028,524 (GRCm39) probably null Het
Gmeb1 C A 4: 131,953,085 (GRCm39) L560F probably damaging Het
Hace1 T C 10: 45,546,722 (GRCm39) L452P probably damaging Het
Hecw2 T A 1: 53,943,502 (GRCm39) H975L probably damaging Het
Idh2 GGTCCCAG GG 7: 79,748,077 (GRCm39) probably benign Het
Il1r2 T A 1: 40,162,370 (GRCm39) C338S probably damaging Het
Iqcn T C 8: 71,169,921 (GRCm39) I1337T probably benign Het
Kcnb1 T C 2: 167,030,204 (GRCm39) S114G probably damaging Het
Lce1c A T 3: 92,587,623 (GRCm39) T17S unknown Het
Lhfpl4 C A 6: 113,153,627 (GRCm39) L141F possibly damaging Het
Ms4a14 T C 19: 11,279,594 (GRCm39) E988G possibly damaging Het
Naip5 G T 13: 100,356,205 (GRCm39) Q1137K not run Het
Naip5 T C 13: 100,356,204 (GRCm39) Q1137R probably benign Het
Neurod1 T A 2: 79,285,290 (GRCm39) D31V probably benign Het
Neurod4 A G 10: 130,106,927 (GRCm39) C116R probably damaging Het
Nisch A G 14: 30,928,537 (GRCm39) V28A probably benign Het
Odad1 A C 7: 45,592,189 (GRCm39) Q323P probably damaging Het
Or4a72 A G 2: 89,405,449 (GRCm39) V207A probably benign Het
Or5d44 T G 2: 88,141,772 (GRCm39) M123L probably benign Het
Pabpc4l T A 3: 46,401,024 (GRCm39) R207W probably damaging Het
Pabpc4l A T 3: 46,400,687 (GRCm39) I319N probably damaging Het
Pcm1 G A 8: 41,762,568 (GRCm39) D1371N probably damaging Het
Plxnc1 C T 10: 94,706,867 (GRCm39) A557T probably benign Het
Prkdc T A 16: 15,466,602 (GRCm39) V58D probably damaging Het
Prpf40a A G 2: 53,046,959 (GRCm39) V259A probably benign Het
Psmd3 A T 11: 98,576,466 (GRCm39) T123S probably benign Het
Ptgr2 G T 12: 84,339,103 (GRCm39) probably benign Het
Ptprr A G 10: 115,884,141 (GRCm39) H66R probably benign Het
Rftn2 A G 1: 55,233,401 (GRCm39) probably null Het
Rsph14 T A 10: 74,865,628 (GRCm39) E70V possibly damaging Het
Slc24a5 G A 2: 124,930,111 (GRCm39) V471I probably benign Het
Sorbs1 G C 19: 40,365,244 (GRCm39) R180G probably benign Het
Spag9 A T 11: 93,988,515 (GRCm39) T862S probably benign Het
Ssbp2 T A 13: 91,839,002 (GRCm39) D291E probably benign Het
Supt5 T C 7: 28,023,197 (GRCm39) K329E probably damaging Het
Syne2 G T 12: 76,014,155 (GRCm39) K3115N probably damaging Het
Tars1 A T 15: 11,392,095 (GRCm39) L239* probably null Het
Tbxa2r T C 10: 81,168,625 (GRCm39) Y105H probably benign Het
Tesk1 T A 4: 43,445,743 (GRCm39) D265E probably damaging Het
Tril T C 6: 53,795,266 (GRCm39) D652G possibly damaging Het
Tsga10 T C 1: 37,873,268 (GRCm39) R204G probably null Het
Twnk A G 19: 45,000,219 (GRCm39) D645G probably benign Het
Umodl1 A T 17: 31,217,122 (GRCm39) D1118V probably damaging Het
Unc119 T C 11: 78,238,071 (GRCm39) I83T probably benign Het
Unc80 T C 1: 66,685,574 (GRCm39) W2233R possibly damaging Het
Vmn1r45 T A 6: 89,910,416 (GRCm39) T185S possibly damaging Het
Vmn2r111 G T 17: 22,790,067 (GRCm39) T313K possibly damaging Het
Wdr4 A G 17: 31,728,806 (GRCm39) L123S probably damaging Het
Zfpm2 A G 15: 40,966,386 (GRCm39) E957G possibly damaging Het
Other mutations in Peg10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02029:Peg10 APN 6 4,754,473 (GRCm39) utr 5 prime probably benign
IGL03063:Peg10 APN 6 4,756,647 (GRCm39) utr 3 prime probably benign
piaggio UTSW 6 4,756,427 (GRCm39) utr 3 prime probably benign
PIT4480001:Peg10 UTSW 6 4,756,560 (GRCm39) missense unknown
R0090:Peg10 UTSW 6 4,756,063 (GRCm39) utr 3 prime probably benign
R0148:Peg10 UTSW 6 4,755,711 (GRCm39) missense possibly damaging 0.88
R0650:Peg10 UTSW 6 4,756,475 (GRCm39) small insertion probably benign
R0698:Peg10 UTSW 6 4,756,835 (GRCm39) utr 3 prime probably benign
R1600:Peg10 UTSW 6 4,757,080 (GRCm39) utr 3 prime probably benign
R1842:Peg10 UTSW 6 4,756,381 (GRCm39) utr 3 prime probably benign
R1930:Peg10 UTSW 6 4,755,778 (GRCm39) missense probably damaging 0.99
R1931:Peg10 UTSW 6 4,755,778 (GRCm39) missense probably damaging 0.99
R2162:Peg10 UTSW 6 4,755,914 (GRCm39) utr 3 prime probably benign
R2215:Peg10 UTSW 6 4,756,918 (GRCm39) utr 3 prime probably benign
R2339:Peg10 UTSW 6 4,756,102 (GRCm39) utr 3 prime probably benign
R2847:Peg10 UTSW 6 4,756,912 (GRCm39) utr 3 prime probably benign
R2848:Peg10 UTSW 6 4,756,912 (GRCm39) utr 3 prime probably benign
R3000:Peg10 UTSW 6 4,754,276 (GRCm39) utr 5 prime probably benign
R3056:Peg10 UTSW 6 4,755,029 (GRCm39) missense possibly damaging 0.66
R4051:Peg10 UTSW 6 4,754,534 (GRCm39) missense probably benign 0.00
R4059:Peg10 UTSW 6 4,756,427 (GRCm39) utr 3 prime probably benign
R4296:Peg10 UTSW 6 4,756,472 (GRCm39) small insertion probably benign
R4626:Peg10 UTSW 6 4,756,460 (GRCm39) small insertion probably benign
R4634:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R4679:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R4834:Peg10 UTSW 6 4,754,294 (GRCm39) utr 5 prime probably benign
R4982:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R4983:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R4996:Peg10 UTSW 6 4,756,454 (GRCm39) small insertion probably benign
R4997:Peg10 UTSW 6 4,756,457 (GRCm39) small insertion probably benign
R5015:Peg10 UTSW 6 4,756,453 (GRCm39) small insertion probably benign
R5085:Peg10 UTSW 6 4,755,864 (GRCm39) utr 3 prime probably benign
R5091:Peg10 UTSW 6 4,754,511 (GRCm39) missense probably benign 0.01
R5231:Peg10 UTSW 6 4,756,939 (GRCm39) utr 3 prime probably benign
R5278:Peg10 UTSW 6 4,756,442 (GRCm39) small deletion probably benign
R5364:Peg10 UTSW 6 4,756,128 (GRCm39) utr 3 prime probably benign
R5397:Peg10 UTSW 6 4,756,453 (GRCm39) small insertion probably benign
R5485:Peg10 UTSW 6 4,755,565 (GRCm39) missense probably benign 0.09
R5573:Peg10 UTSW 6 4,755,913 (GRCm39) utr 3 prime probably benign
R5710:Peg10 UTSW 6 4,756,351 (GRCm39) small insertion probably benign
R5710:Peg10 UTSW 6 4,756,350 (GRCm39) small insertion probably benign
R5736:Peg10 UTSW 6 4,754,423 (GRCm39) missense probably benign 0.00
R5865:Peg10 UTSW 6 4,754,375 (GRCm39) missense probably damaging 0.98
R6056:Peg10 UTSW 6 4,756,449 (GRCm39) small insertion probably benign
R6116:Peg10 UTSW 6 4,756,351 (GRCm39) small insertion probably benign
R6129:Peg10 UTSW 6 4,756,449 (GRCm39) small insertion probably benign
R6147:Peg10 UTSW 6 4,754,499 (GRCm39) start gained probably benign
R6171:Peg10 UTSW 6 4,756,449 (GRCm39) small insertion probably benign
R6194:Peg10 UTSW 6 4,756,351 (GRCm39) small insertion probably benign
R6197:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R6207:Peg10 UTSW 6 4,756,449 (GRCm39) small insertion probably benign
R6215:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R6276:Peg10 UTSW 6 4,756,449 (GRCm39) small insertion probably benign
R6281:Peg10 UTSW 6 4,756,449 (GRCm39) small insertion probably benign
R6287:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R6302:Peg10 UTSW 6 4,756,449 (GRCm39) small insertion probably benign
R6393:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R6394:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R6405:Peg10 UTSW 6 4,756,453 (GRCm39) small insertion probably benign
R6421:Peg10 UTSW 6 4,756,449 (GRCm39) small insertion probably benign
R6486:Peg10 UTSW 6 4,756,449 (GRCm39) small insertion probably benign
R6538:Peg10 UTSW 6 4,756,449 (GRCm39) small insertion probably benign
R6668:Peg10 UTSW 6 4,754,502 (GRCm39) missense probably benign 0.01
R6679:Peg10 UTSW 6 4,754,276 (GRCm39) utr 5 prime probably benign
R6685:Peg10 UTSW 6 4,754,738 (GRCm39) missense probably damaging 1.00
R6702:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R6706:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R6747:Peg10 UTSW 6 4,757,137 (GRCm39) utr 3 prime probably benign
R6775:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R6811:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R6823:Peg10 UTSW 6 4,756,431 (GRCm39) small deletion probably benign
R6826:Peg10 UTSW 6 4,756,353 (GRCm39) small insertion probably benign
R6847:Peg10 UTSW 6 4,754,279 (GRCm39) utr 5 prime probably benign
R6861:Peg10 UTSW 6 4,756,351 (GRCm39) small insertion probably benign
R6861:Peg10 UTSW 6 4,756,350 (GRCm39) small insertion probably benign
R6876:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R6891:Peg10 UTSW 6 4,756,449 (GRCm39) small insertion probably benign
R6911:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R6973:Peg10 UTSW 6 4,756,431 (GRCm39) small deletion probably benign
R6990:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R6998:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R7070:Peg10 UTSW 6 4,756,454 (GRCm39) small insertion probably benign
R7120:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R7132:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R7140:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R7189:Peg10 UTSW 6 4,756,431 (GRCm39) small deletion probably benign
R7208:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R7256:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R7260:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R7261:Peg10 UTSW 6 4,756,591 (GRCm39) missense unknown
R7409:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R7439:Peg10 UTSW 6 4,756,453 (GRCm39) small insertion probably benign
R7475:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R7483:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R7502:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R7515:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R7520:Peg10 UTSW 6 4,756,796 (GRCm39) missense unknown
R7544:Peg10 UTSW 6 4,756,427 (GRCm39) frame shift probably null
R7571:Peg10 UTSW 6 4,756,082 (GRCm39) missense unknown
R7581:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R7635:Peg10 UTSW 6 4,754,938 (GRCm39) missense probably damaging 0.99
R7677:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R7697:Peg10 UTSW 6 4,756,453 (GRCm39) small insertion probably benign
R7710:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R7803:Peg10 UTSW 6 4,756,431 (GRCm39) small deletion probably benign
R7816:Peg10 UTSW 6 4,756,453 (GRCm39) small insertion probably benign
R7820:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R7827:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R7861:Peg10 UTSW 6 4,756,431 (GRCm39) small deletion probably benign
R7881:Peg10 UTSW 6 4,756,454 (GRCm39) small insertion probably benign
R7904:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R7915:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R7916:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R7963:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R8016:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R8037:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R8062:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R8081:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R8113:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R8115:Peg10 UTSW 6 4,756,707 (GRCm39) missense unknown
R8140:Peg10 UTSW 6 4,756,113 (GRCm39) missense unknown
R8178:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R8233:Peg10 UTSW 6 4,756,453 (GRCm39) small insertion probably benign
R8239:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R8281:Peg10 UTSW 6 4,756,431 (GRCm39) small deletion probably benign
R8310:Peg10 UTSW 6 4,756,454 (GRCm39) small insertion probably benign
R8312:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R8330:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R8338:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R8354:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R8387:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R8390:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R8408:Peg10 UTSW 6 4,756,453 (GRCm39) small insertion probably benign
R8415:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R8439:Peg10 UTSW 6 4,755,462 (GRCm39) missense possibly damaging 0.58
R8444:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R8463:Peg10 UTSW 6 4,756,453 (GRCm39) small insertion probably benign
R8477:Peg10 UTSW 6 4,756,453 (GRCm39) small insertion probably benign
R8507:Peg10 UTSW 6 4,756,453 (GRCm39) small insertion probably benign
R8552:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R8678:Peg10 UTSW 6 4,756,431 (GRCm39) small deletion probably benign
R8699:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R8700:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R8705:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R8765:Peg10 UTSW 6 4,754,492 (GRCm39) missense unknown
R8824:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R8859:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R8870:Peg10 UTSW 6 4,754,825 (GRCm39) missense probably damaging 0.99
R8909:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R8918:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R8924:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R8925:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R8930:Peg10 UTSW 6 4,756,449 (GRCm39) small insertion probably benign
R8950:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R8960:Peg10 UTSW 6 4,756,449 (GRCm39) small insertion probably benign
R8975:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R8988:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R9046:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R9068:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R9074:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R9088:Peg10 UTSW 6 4,756,453 (GRCm39) small insertion probably benign
R9094:Peg10 UTSW 6 4,756,449 (GRCm39) small insertion probably benign
R9114:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R9116:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R9135:Peg10 UTSW 6 4,756,453 (GRCm39) small insertion probably benign
R9137:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R9139:Peg10 UTSW 6 4,757,128 (GRCm39) missense unknown
R9139:Peg10 UTSW 6 4,756,449 (GRCm39) small insertion probably benign
R9171:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R9173:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R9213:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R9216:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R9229:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R9233:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R9283:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R9328:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R9367:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R9369:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R9405:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R9410:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R9412:Peg10 UTSW 6 4,756,453 (GRCm39) small insertion probably benign
R9421:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R9437:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R9440:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R9460:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R9492:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R9495:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R9500:Peg10 UTSW 6 4,756,871 (GRCm39) missense unknown
R9511:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R9515:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R9576:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R9610:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R9611:Peg10 UTSW 6 4,756,453 (GRCm39) small insertion probably benign
R9611:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R9614:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R9619:Peg10 UTSW 6 4,755,316 (GRCm39) missense probably benign 0.02
R9646:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R9655:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R9673:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R9675:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R9696:Peg10 UTSW 6 4,756,431 (GRCm39) small deletion probably benign
R9749:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R9756:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
X0065:Peg10 UTSW 6 4,756,515 (GRCm39) utr 3 prime probably benign
Z1176:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
Predicted Primers PCR Primer
(F):5'- GTTTACAGTGCCACAACCG -3'
(R):5'- ACCTTACAGGGTGGTAAATTCTG -3'

Sequencing Primer
(F):5'- TCAGCATGAGCATCTGCATG -3'
(R):5'- GGTGGTAAATTCTGAATCCAGCC -3'
Posted On 2019-09-13