Mutagenetix > Incidental Mutation

Incidental Mutation 'R7401:Cd207'

574162

Institutional Source

Beutler Lab

Gene Symbol

Cd207

Ensembl Gene

ENSMUSG00000034783

Gene Name

CD207 antigen

Synonyms

Langerin

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.048) question?

Stock #

R7401 (G1)

Quality Score

159.009

Status

Not validated

Chromosome

Chromosomal Location

83671215-83677857 bp(-) (GRCm38)

Type of Mutation

start gained

DNA Base Change (assembly)

A to C at 83677848 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000040746 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037882]

AlphaFold

Q8VBX4

Predicted Effect

probably benign
Transcript: ENSMUST00000037882

SMART Domains

Protein: ENSMUSP00000040746
Gene: ENSMUSG00000034783

Domain	Start	End	E-Value	Type
low complexity region	1	13	N/A	INTRINSIC
transmembrane domain	45	67	N/A	INTRINSIC
CLECT	198	323	9.42e-30	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is expressed only in Langerhans cells which are immature dendritic cells of the epidermis and mucosa. It is localized in the Birbeck granules, organelles present in the cytoplasm of Langerhans cells and consisting of superimposed and zippered membranes. It is a C-type lectin with mannose binding specificity, and it has been proposed that mannose binding by this protein leads to internalization of antigen into Birbeck granules and providing access to a nonclassical antigen-processing pathway. Mutations in this gene result in Birbeck granules deficiency or loss of sugar binding activity. [provided by RefSeq, Aug 2010]
PHENOTYPE: Nullizygous mice lack Birbeck granules with no marked loss of Langerhans cell (LC) function. Knock-in mice expressing diphtheria toxin (DT) receptors show LC depletion. Heterozygotes for a knock-in allele show DT-induced LC ablation, altered contact hypersensitivity and susceptibility to infection. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610318N02Rik	A	T	16: 17,118,404	L152Q	probably benign	Het
Abcg3	A	T	5: 104,966,774	N292K	probably damaging	Het
Adamts3	T	A	5: 89,707,450		probably null	Het
Adgrg7	T	C	16: 56,742,418	N519D	probably benign	Het
Adsl	A	G	15: 80,962,782	H263R	probably damaging	Het
Ak9	A	T	10: 41,423,004	D1567V	unknown	Het
Bscl2	T	C	19: 8,846,550	F280L	possibly damaging	Het
Cacna1b	T	A	2: 24,679,294	T873S	probably benign	Het
Cacna1c	T	C	6: 119,052,708		probably null	Het
Cast	G	T	13: 74,808,458	A18E	unknown	Het
Ccdc114	A	C	7: 45,942,765	Q323P	probably damaging	Het
Cd79b	A	G	11: 106,312,852	S130P	probably benign	Het
Cfap52	A	T	11: 67,949,633	N157K	probably benign	Het
Cfap57	C	T	4: 118,614,931	V84I	probably benign	Het
Chaf1b	G	T	16: 93,884,380		probably benign	Het
Cntn1	A	G	15: 92,317,989	I968V	probably benign	Het
Cntn5	C	T	9: 9,833,461	V362I	probably benign	Het
Crem	A	G	18: 3,295,329	S80P	probably damaging	Het
Csnk1g3	C	T	18: 53,930,318	T267I	probably damaging	Het
Cyth1	A	T	11: 118,182,251	N274K	possibly damaging	Het
Dicer1	C	T	12: 104,712,278	G594S	probably benign	Het
Enpp1	C	T	10: 24,645,282	C849Y	probably damaging	Het
Fam193a	A	G	5: 34,465,635	E1189G	possibly damaging	Het
Fermt1	C	A	2: 132,917,559	V426L	probably benign	Het
Fes	A	G	7: 80,378,776		probably null	Het
Gm16486	T	C	8: 70,717,272	I1337T	probably benign	Het
Gmeb1	C	A	4: 132,225,774	L560F	probably damaging	Het
Hace1	T	C	10: 45,670,626	L452P	probably damaging	Het
Hecw2	T	A	1: 53,904,343	H975L	probably damaging	Het
Idh2	GGTCCCAG	GG	7: 80,098,329		probably benign	Het
Il1r2	T	A	1: 40,123,210	C338S	probably damaging	Het
Kcnb1	T	C	2: 167,188,284	S114G	probably damaging	Het
Lce1c	A	T	3: 92,680,316	T17S	unknown	Het
Lhfpl4	C	A	6: 113,176,666	L141F	possibly damaging	Het
Ms4a14	T	C	19: 11,302,230	E988G	possibly damaging	Het
Naip5	T	C	13: 100,219,696	Q1137R	probably benign	Het
Naip5	G	T	13: 100,219,697	Q1137K	not run	Het
Neurod1	T	A	2: 79,454,946	D31V	probably benign	Het
Neurod4	A	G	10: 130,271,058	C116R	probably damaging	Het
Nisch	A	G	14: 31,206,580	V28A	probably benign	Het
Olfr1174-ps	T	G	2: 88,311,428	M123L	probably benign	Het
Olfr1245	A	G	2: 89,575,105	V207A	probably benign	Het
Pabpc4l	A	T	3: 46,446,252	I319N	probably damaging	Het
Pabpc4l	T	A	3: 46,446,589	R207W	probably damaging	Het
Pcm1	G	A	8: 41,309,531	D1371N	probably damaging	Het
Peg10	G	GGTC	6: 4,756,452		probably benign	Het
Plxnc1	C	T	10: 94,871,005	A557T	probably benign	Het
Prkdc	T	A	16: 15,648,738	V58D	probably damaging	Het
Prpf40a	A	G	2: 53,156,947	V259A	probably benign	Het
Psmd3	A	T	11: 98,685,640	T123S	probably benign	Het
Ptgr2	G	T	12: 84,292,329		probably benign	Het
Ptprr	A	G	10: 116,048,236	H66R	probably benign	Het
Rftn2	A	G	1: 55,194,242		probably null	Het
Rsph14	T	A	10: 75,029,796	E70V	possibly damaging	Het
Slc24a5	G	A	2: 125,088,191	V471I	probably benign	Het
Sorbs1	G	C	19: 40,376,800	R180G	probably benign	Het
Spag9	A	T	11: 94,097,689	T862S	probably benign	Het
Ssbp2	T	A	13: 91,690,883	D291E	probably benign	Het
Supt5	T	C	7: 28,323,772	K329E	probably damaging	Het
Syne2	G	T	12: 75,967,381	K3115N	probably damaging	Het
Tars	A	T	15: 11,392,009	L239*	probably null	Het
Tbxa2r	T	C	10: 81,332,791	Y105H	probably benign	Het
Tesk1	T	A	4: 43,445,743	D265E	probably damaging	Het
Tril	T	C	6: 53,818,281	D652G	possibly damaging	Het
Tsga10	T	C	1: 37,834,187	R204G	probably null	Het
Twnk	A	G	19: 45,011,780	D645G	probably benign	Het
Umodl1	A	T	17: 30,998,148	D1118V	probably damaging	Het
Unc119	T	C	11: 78,347,245	I83T	probably benign	Het
Unc80	T	C	1: 66,646,415	W2233R	possibly damaging	Het
Vmn1r45	T	A	6: 89,933,434	T185S	possibly damaging	Het
Vmn2r111	G	T	17: 22,571,086	T313K	possibly damaging	Het
Wdr4	A	G	17: 31,509,832	L123S	probably damaging	Het
Zfpm2	A	G	15: 41,102,990	E957G	possibly damaging	Het

Other mutations in Cd207

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00662:Cd207	APN	6	83675926	missense	possibly damaging	0.95
IGL01101:Cd207	APN	6	83675857	missense	probably benign	0.25
IGL02504:Cd207	APN	6	83677806	utr 5 prime	probably benign
IGL03309:Cd207	APN	6	83677753	missense	possibly damaging	0.82
R0004:Cd207	UTSW	6	83674248	nonsense	probably null
R0646:Cd207	UTSW	6	83675756	missense	probably benign	0.00
R1709:Cd207	UTSW	6	83672836	missense	possibly damaging	0.92
R1756:Cd207	UTSW	6	83675597	missense	probably benign
R1867:Cd207	UTSW	6	83675653	missense	probably damaging	0.99
R1868:Cd207	UTSW	6	83671701	nonsense	probably null
R1955:Cd207	UTSW	6	83671775	missense	probably benign	0.42
R5005:Cd207	UTSW	6	83674385	missense	possibly damaging	0.95
R5024:Cd207	UTSW	6	83674319	missense	probably damaging	1.00
R6430:Cd207	UTSW	6	83675887	missense	probably benign	0.06
R8995:Cd207	UTSW	6	83675909	missense	probably damaging	1.00
R9314:Cd207	UTSW	6	83675717	missense	probably damaging	0.98
R9366:Cd207	UTSW	6	83671797	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- TTGTGGGCAGAAGCACCAAG -3'
(R):5'- AGCTCTTAGAAGGCACTCAATG -3'

Sequencing Primer
(F):5'- CACCAAGTGGGCATGGAGC -3'
(R):5'- AGGCACTCAATGTACATTTGTAGGG -3'

Posted On

2019-09-13