Mutagenetix > Incidental Mutations

Incidental Mutation 'R0625:Ttll3'

57417

Institutional Source

Beutler Lab

Gene Symbol

Ttll3

Ensembl Gene

ENSMUSG00000030276

Gene Name

tubulin tyrosine ligase-like family, member 3

Synonyms

MMRRC Submission

038814-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0625 (G1)

Quality Score

142

Status

Not validated

Chromosome

Chromosomal Location

113389260-113414587 bp(+) (GRCm38)

Type of Mutation

critical splice acceptor site

DNA Base Change (assembly)

A to G at 113408903 bp

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032414] [ENSMUST00000038889] [ENSMUST00000038889] [ENSMUST00000205017]

Predicted Effect

probably null
Transcript: ENSMUST00000032414

SMART Domains

Protein: ENSMUSP00000032414
Gene: ENSMUSG00000030276

Domain	Start	End	E-Value	Type
low complexity region	3	20	N/A	INTRINSIC
low complexity region	214	231	N/A	INTRINSIC
low complexity region	234	248	N/A	INTRINSIC
Pfam:TTL	404	698	7.7e-84	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000038889

SMART Domains

Protein: ENSMUSP00000037870
Gene: ENSMUSG00000030276

Domain	Start	End	E-Value	Type
low complexity region	3	20	N/A	INTRINSIC
low complexity region	214	231	N/A	INTRINSIC
low complexity region	234	248	N/A	INTRINSIC
Pfam:TTL	404	699	9e-85	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000038889

SMART Domains

Protein: ENSMUSP00000037870
Gene: ENSMUSG00000030276

Domain	Start	End	E-Value	Type
low complexity region	3	20	N/A	INTRINSIC
low complexity region	214	231	N/A	INTRINSIC
low complexity region	234	248	N/A	INTRINSIC
Pfam:TTL	404	699	9e-85	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000129582

Predicted Effect

probably null
Transcript: ENSMUST00000138131

Predicted Effect

probably null
Transcript: ENSMUST00000203524

Predicted Effect

probably null
Transcript: ENSMUST00000203524

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000203880

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000203925

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000204255

Predicted Effect

probably benign
Transcript: ENSMUST00000205017

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.5%
20x: 95.2%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit a reduced number of primary cilia in colon epithelia accompanied by an increased rate of cell division which is compensated by faster tissue turnover in the colon. Mice exhibit increased incidence of colon tumors by chemical induction. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930550C14Rik	T	C	9: 53,408,065	S2P	probably benign	Het
Abca16	A	C	7: 120,435,893	T301P	probably damaging	Het
Acer2	A	G	4: 86,887,162	D121G	possibly damaging	Het
Adgrd1	T	C	5: 129,171,931		probably null	Het
Arhgap11a	T	C	2: 113,841,711	I249V	probably benign	Het
Arhgap22	A	G	14: 33,366,714	E219G	probably benign	Het
C2cd4b	T	A	9: 67,759,751	S10T	probably benign	Het
Cnot6	A	T	11: 49,683,171	I224N	probably damaging	Het
Ctrc	T	C	4: 141,841,518	T125A	probably damaging	Het
Cxxc5	T	G	18: 35,858,589	S14R	unknown	Het
Cyp4f37	T	G	17: 32,634,678	F445L	probably damaging	Het
Dcbld1	T	G	10: 52,312,850	I186S	probably benign	Het
Dmxl2	T	C	9: 54,382,702	T2510A	probably benign	Het
Dnah3	A	G	7: 120,071,887	I591T	possibly damaging	Het
Dock5	A	T	14: 67,841,163	I204N	probably benign	Het
Dysf	G	A	6: 84,111,987		probably null	Het
Erich5	A	G	15: 34,471,369	E248G	probably damaging	Het
Fam160a1	A	G	3: 85,730,500	V164A	possibly damaging	Het
Foxm1	A	G	6: 128,373,871	S712G	probably damaging	Het
Frmpd1	A	G	4: 45,284,055	T959A	probably benign	Het
Gfra4	C	T	2: 131,040,256	V277I	probably null	Het
Hacd4	T	C	4: 88,435,010	I82V	probably benign	Het
Itih2	C	T	2: 10,123,414	V159I	possibly damaging	Het
Itpr2	T	A	6: 146,166,651	M2410L	probably benign	Het
March11	A	G	15: 26,311,043	I202V	probably damaging	Het
March3	A	G	18: 56,811,830		probably null	Het
Med12l	G	A	3: 59,247,437	E1135K	probably damaging	Het
Mib2	C	T	4: 155,659,460	G42S	probably damaging	Het
Mlx	T	C	11: 101,087,782	L78P	possibly damaging	Het
Muc5b	T	C	7: 141,846,427	C473R	unknown	Het
N4bp2l1	T	A	5: 150,576,745	R66*	probably null	Het
Nes	A	G	3: 87,977,172	T913A	possibly damaging	Het
Oas1a	T	C	5: 120,899,259	E235G	probably damaging	Het
Olfr1104	T	A	2: 87,021,620	H308L	probably benign	Het
Olfr477	T	C	7: 107,991,189	S275P	probably damaging	Het
Olfr905	T	C	9: 38,473,208	S154P	possibly damaging	Het
Parn	C	T	16: 13,640,294	V286I	probably benign	Het
Paxip1	G	A	5: 27,765,942	Q470*	probably null	Het
Phc2	C	G	4: 128,723,710	H510D	possibly damaging	Het
Pla2g4f	T	A	2: 120,305,041	D384V	probably damaging	Het
Plpbp	A	T	8: 27,045,131	N68I	probably damaging	Het
Podxl2	G	A	6: 88,849,955	A123V	possibly damaging	Het
Pole	A	T	5: 110,325,550	T1737S	possibly damaging	Het
Ppp3cc	T	C	14: 70,225,027	E396G	probably damaging	Het
Pramel7	T	A	2: 87,491,008	I228F	probably benign	Het
Prl7d1	A	T	13: 27,710,140	C149S	probably benign	Het
Qtrt1	G	T	9: 21,418,288	M217I	probably benign	Het
Sec24a	T	A	11: 51,729,454	D456V	probably damaging	Het
Shox2	T	G	3: 66,981,544		probably null	Het
Skint2	T	A	4: 112,624,086	S49T	probably damaging	Het
Smarca5	A	G	8: 80,720,686		probably null	Het
Sorcs2	T	A	5: 36,024,572	D1068V	possibly damaging	Het
Tmem114	T	C	16: 8,412,102		probably null	Het
Ttc7b	T	A	12: 100,355,046	M24L	probably benign	Het
Usp7	C	T	16: 8,704,982	D102N	probably benign	Het

Other mutations in Ttll3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01338:Ttll3	APN	6	113394729	missense	probably damaging	1.00
IGL01677:Ttll3	APN	6	113412984	missense	probably benign
IGL01697:Ttll3	APN	6	113399729	missense	probably benign	0.00
IGL01944:Ttll3	APN	6	113414115	missense	probably benign
IGL02688:Ttll3	APN	6	113399739	missense	probably benign	0.00
IGL03068:Ttll3	APN	6	113409197	missense	probably damaging	1.00
R0373:Ttll3	UTSW	6	113398777	missense	probably damaging	1.00
R0472:Ttll3	UTSW	6	113409339	missense	probably damaging	1.00
R1868:Ttll3	UTSW	6	113392764	missense	possibly damaging	0.95
R2026:Ttll3	UTSW	6	113398770	missense	probably damaging	1.00
R2061:Ttll3	UTSW	6	113409042	missense	possibly damaging	0.76
R2128:Ttll3	UTSW	6	113412934	missense	probably benign	0.31
R2896:Ttll3	UTSW	6	113392722	missense	probably benign	0.15
R2903:Ttll3	UTSW	6	113407323	missense	probably damaging	0.99
R2906:Ttll3	UTSW	6	113392510	unclassified	probably benign
R4659:Ttll3	UTSW	6	113414141	missense	probably benign
R4746:Ttll3	UTSW	6	113407392	missense	probably damaging	1.00
R4984:Ttll3	UTSW	6	113412940	missense	probably benign	0.00
R5358:Ttll3	UTSW	6	113401331	missense	probably benign	0.26
R5372:Ttll3	UTSW	6	113401421	nonsense	probably null
R5525:Ttll3	UTSW	6	113412978	missense	probably benign
R5548:Ttll3	UTSW	6	113393117	missense	probably damaging	1.00
R5694:Ttll3	UTSW	6	113399708	missense	probably damaging	1.00
R5993:Ttll3	UTSW	6	113398031	nonsense	probably null
R6119:Ttll3	UTSW	6	113394741	missense	probably damaging	1.00
R6268:Ttll3	UTSW	6	113392563	missense	probably benign	0.00
R6719:Ttll3	UTSW	6	113399032	intron	probably benign
R6852:Ttll3	UTSW	6	113399155	frame shift	probably null
R6852:Ttll3	UTSW	6	113399157	frame shift	probably null
R6852:Ttll3	UTSW	6	113399159	frame shift	probably null
R6853:Ttll3	UTSW	6	113399157	frame shift	probably null
R6854:Ttll3	UTSW	6	113399157	frame shift	probably null
R7170:Ttll3	UTSW	6	113413878	missense	probably benign	0.41
R7239:Ttll3	UTSW	6	113399157	frame shift	probably null
R7302:Ttll3	UTSW	6	113409285	missense	probably damaging	1.00
R7330:Ttll3	UTSW	6	113399157	frame shift	probably null
R7330:Ttll3	UTSW	6	113399164	frame shift	probably null
R7586:Ttll3	UTSW	6	113399157	frame shift	probably null
R7587:Ttll3	UTSW	6	113399157	frame shift	probably null
R7701:Ttll3	UTSW	6	113399157	frame shift	probably null
R7702:Ttll3	UTSW	6	113399157	frame shift	probably null
R7774:Ttll3	UTSW	6	113399160	frame shift	probably null
R7775:Ttll3	UTSW	6	113399158	nonsense	probably null
R7775:Ttll3	UTSW	6	113399160	frame shift	probably null
R7776:Ttll3	UTSW	6	113399159	frame shift	probably null
R7793:Ttll3	UTSW	6	113399158	frame shift	probably null
R7793:Ttll3	UTSW	6	113399159	frame shift	probably null
R7797:Ttll3	UTSW	6	113394777	missense	possibly damaging	0.76
R7824:Ttll3	UTSW	6	113399157	frame shift	probably null
R7824:Ttll3	UTSW	6	113399161	frame shift	probably null
R7824:Ttll3	UTSW	6	113399164	frame shift	probably null
R7825:Ttll3	UTSW	6	113399157	frame shift	probably null
R7825:Ttll3	UTSW	6	113399159	frame shift	probably null
R7826:Ttll3	UTSW	6	113399157	frame shift	probably null
R7826:Ttll3	UTSW	6	113399159	frame shift	probably null
R7826:Ttll3	UTSW	6	113399160	frame shift	probably null
R7826:Ttll3	UTSW	6	113399161	frame shift	probably null
R7827:Ttll3	UTSW	6	113399157	frame shift	probably null
R7827:Ttll3	UTSW	6	113399162	frame shift	probably null
R7831:Ttll3	UTSW	6	113399155	frame shift	probably null
R7831:Ttll3	UTSW	6	113399157	frame shift	probably null
R7831:Ttll3	UTSW	6	113399159	frame shift	probably null
R7832:Ttll3	UTSW	6	113399155	frame shift	probably null
R7832:Ttll3	UTSW	6	113399157	frame shift	probably null
R7833:Ttll3	UTSW	6	113409337	missense	probably damaging	1.00
R7914:Ttll3	UTSW	6	113399157	frame shift	probably null
R7915:Ttll3	UTSW	6	113399157	frame shift	probably null
R7916:Ttll3	UTSW	6	113409337	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTGAGTCCTGGCCTTAGGCAAATG -3'
(R):5'- TGAGCTATGTCTCACACCAGATCCC -3'

Sequencing Primer
(F):5'- GCCTTAGGCAAATGGGGTG -3'
(R):5'- GATTTCAATCAACCAGGGCTG -3'

Posted On

2013-07-11