Mutagenetix > Incidental Mutation

Incidental Mutation 'R7401:Pcm1'

574170

Institutional Source

Beutler Lab

Gene Symbol

Pcm1

Ensembl Gene

ENSMUSG00000031592

Gene Name

pericentriolar material 1

Synonyms

9430077F19Rik, 2600002H09Rik, C030044G17Rik

MMRRC Submission

Accession Numbers

Genbank: NM_023662; MGI: 1277958

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7401 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

41239752-41332344 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 41309531 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Asparagine at position 1371 (D1371N)

Ref Sequence

ENSEMBL: ENSMUSP00000039709 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045218] [ENSMUST00000211247]

AlphaFold

Q9R0L6

Predicted Effect

probably damaging
Transcript: ENSMUST00000045218
AA Change: D1371N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000039709
Gene: ENSMUSG00000031592
AA Change: D1371N

Domain	Start	End	E-Value	Type
coiled coil region	218	238	N/A	INTRINSIC
coiled coil region	270	301	N/A	INTRINSIC
coiled coil region	399	426	N/A	INTRINSIC
coiled coil region	492	520	N/A	INTRINSIC
low complexity region	527	548	N/A	INTRINSIC
low complexity region	622	647	N/A	INTRINSIC
coiled coil region	652	683	N/A	INTRINSIC
coiled coil region	724	772	N/A	INTRINSIC
coiled coil region	822	856	N/A	INTRINSIC
coiled coil region	988	1017	N/A	INTRINSIC
low complexity region	1021	1033	N/A	INTRINSIC
low complexity region	1287	1301	N/A	INTRINSIC
Pfam:PCM1_C	1369	1999	3.6e-295	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000211247
AA Change: D1410N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of centriolar satellites, which are electron dense granules scattered around centrosomes. Inhibition studies show that this protein is essential for the correct localization of several centrosomal proteins, and for anchoring microtubules to the centrosome. Chromosomal aberrations involving this gene are associated with papillary thyroid carcinomas and a variety of hematological malignancies, including atypical chronic myeloid leukemia and T-cell lymphoma. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2015]

Allele List at MGI

All alleles(34) : Gene trapped(34)

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610318N02Rik	A	T	16: 17,118,404	L152Q	probably benign	Het
Abcg3	A	T	5: 104,966,774	N292K	probably damaging	Het
Adamts3	T	A	5: 89,707,450		probably null	Het
Adgrg7	T	C	16: 56,742,418	N519D	probably benign	Het
Adsl	A	G	15: 80,962,782	H263R	probably damaging	Het
Ak9	A	T	10: 41,423,004	D1567V	unknown	Het
Bscl2	T	C	19: 8,846,550	F280L	possibly damaging	Het
Cacna1b	T	A	2: 24,679,294	T873S	probably benign	Het
Cacna1c	T	C	6: 119,052,708		probably null	Het
Cast	G	T	13: 74,808,458	A18E	unknown	Het
Ccdc114	A	C	7: 45,942,765	Q323P	probably damaging	Het
Cd207	A	C	6: 83,677,848		probably benign	Het
Cd79b	A	G	11: 106,312,852	S130P	probably benign	Het
Cfap52	A	T	11: 67,949,633	N157K	probably benign	Het
Cfap57	C	T	4: 118,614,931	V84I	probably benign	Het
Chaf1b	G	T	16: 93,884,380		probably benign	Het
Cntn1	A	G	15: 92,317,989	I968V	probably benign	Het
Cntn5	C	T	9: 9,833,461	V362I	probably benign	Het
Crem	A	G	18: 3,295,329	S80P	probably damaging	Het
Csnk1g3	C	T	18: 53,930,318	T267I	probably damaging	Het
Cyth1	A	T	11: 118,182,251	N274K	possibly damaging	Het
Dicer1	C	T	12: 104,712,278	G594S	probably benign	Het
Enpp1	C	T	10: 24,645,282	C849Y	probably damaging	Het
Fam193a	A	G	5: 34,465,635	E1189G	possibly damaging	Het
Fermt1	C	A	2: 132,917,559	V426L	probably benign	Het
Fes	A	G	7: 80,378,776		probably null	Het
Gm16486	T	C	8: 70,717,272	I1337T	probably benign	Het
Gmeb1	C	A	4: 132,225,774	L560F	probably damaging	Het
Hace1	T	C	10: 45,670,626	L452P	probably damaging	Het
Hecw2	T	A	1: 53,904,343	H975L	probably damaging	Het
Idh2	GGTCCCAG	GG	7: 80,098,329		probably benign	Het
Il1r2	T	A	1: 40,123,210	C338S	probably damaging	Het
Kcnb1	T	C	2: 167,188,284	S114G	probably damaging	Het
Lce1c	A	T	3: 92,680,316	T17S	unknown	Het
Lhfpl4	C	A	6: 113,176,666	L141F	possibly damaging	Het
Ms4a14	T	C	19: 11,302,230	E988G	possibly damaging	Het
Naip5	T	C	13: 100,219,696	Q1137R	probably benign	Het
Naip5	G	T	13: 100,219,697	Q1137K	not run	Het
Neurod1	T	A	2: 79,454,946	D31V	probably benign	Het
Neurod4	A	G	10: 130,271,058	C116R	probably damaging	Het
Nisch	A	G	14: 31,206,580	V28A	probably benign	Het
Olfr1174-ps	T	G	2: 88,311,428	M123L	probably benign	Het
Olfr1245	A	G	2: 89,575,105	V207A	probably benign	Het
Pabpc4l	A	T	3: 46,446,252	I319N	probably damaging	Het
Pabpc4l	T	A	3: 46,446,589	R207W	probably damaging	Het
Peg10	G	GGTC	6: 4,756,452		probably benign	Het
Plxnc1	C	T	10: 94,871,005	A557T	probably benign	Het
Prkdc	T	A	16: 15,648,738	V58D	probably damaging	Het
Prpf40a	A	G	2: 53,156,947	V259A	probably benign	Het
Psmd3	A	T	11: 98,685,640	T123S	probably benign	Het
Ptgr2	G	T	12: 84,292,329		probably benign	Het
Ptprr	A	G	10: 116,048,236	H66R	probably benign	Het
Rftn2	A	G	1: 55,194,242		probably null	Het
Rsph14	T	A	10: 75,029,796	E70V	possibly damaging	Het
Slc24a5	G	A	2: 125,088,191	V471I	probably benign	Het
Sorbs1	G	C	19: 40,376,800	R180G	probably benign	Het
Spag9	A	T	11: 94,097,689	T862S	probably benign	Het
Ssbp2	T	A	13: 91,690,883	D291E	probably benign	Het
Supt5	T	C	7: 28,323,772	K329E	probably damaging	Het
Syne2	G	T	12: 75,967,381	K3115N	probably damaging	Het
Tars	A	T	15: 11,392,009	L239*	probably null	Het
Tbxa2r	T	C	10: 81,332,791	Y105H	probably benign	Het
Tesk1	T	A	4: 43,445,743	D265E	probably damaging	Het
Tril	T	C	6: 53,818,281	D652G	possibly damaging	Het
Tsga10	T	C	1: 37,834,187	R204G	probably null	Het
Twnk	A	G	19: 45,011,780	D645G	probably benign	Het
Umodl1	A	T	17: 30,998,148	D1118V	probably damaging	Het
Unc119	T	C	11: 78,347,245	I83T	probably benign	Het
Unc80	T	C	1: 66,646,415	W2233R	possibly damaging	Het
Vmn1r45	T	A	6: 89,933,434	T185S	possibly damaging	Het
Vmn2r111	G	T	17: 22,571,086	T313K	possibly damaging	Het
Wdr4	A	G	17: 31,509,832	L123S	probably damaging	Het
Zfpm2	A	G	15: 41,102,990	E957G	possibly damaging	Het

Other mutations in Pcm1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00773:Pcm1	APN	8	41274277	missense	probably damaging	1.00
IGL00852:Pcm1	APN	8	41287821	missense	probably damaging	1.00
IGL00896:Pcm1	APN	8	41276123	missense	possibly damaging	0.70
IGL00927:Pcm1	APN	8	41287881	missense	probably damaging	1.00
IGL01085:Pcm1	APN	8	41309603	missense	probably damaging	1.00
IGL01684:Pcm1	APN	8	41257923	missense	probably benign	0.00
IGL01888:Pcm1	APN	8	41257956	missense	probably damaging	0.98
IGL02349:Pcm1	APN	8	41288155	critical splice donor site	probably null
IGL02562:Pcm1	APN	8	41325368	missense	probably damaging	1.00
IGL02807:Pcm1	APN	8	41330882	missense	probably damaging	1.00
IGL03081:Pcm1	APN	8	41275060	missense	probably damaging	1.00
R0090_Pcm1_148	UTSW	8	41256041	missense	probably damaging	0.99
R1534_pcm1_826	UTSW	8	41287701	missense	probably benign
R8169_pcm1_970	UTSW	8	41310116	missense	possibly damaging	0.58
shaved	UTSW	8	41288156	critical splice donor site	probably null
D3080:Pcm1	UTSW	8	41275939	missense	probably damaging	1.00
P0045:Pcm1	UTSW	8	41288097	missense	probably damaging	0.99
R0090:Pcm1	UTSW	8	41256041	missense	probably damaging	0.99
R0109:Pcm1	UTSW	8	41257937	missense	possibly damaging	0.88
R0373:Pcm1	UTSW	8	41276111	nonsense	probably null
R0386:Pcm1	UTSW	8	41316023	missense	probably damaging	1.00
R0452:Pcm1	UTSW	8	41325905	missense	probably benign	0.25
R0498:Pcm1	UTSW	8	41293769	missense	probably benign	0.01
R0528:Pcm1	UTSW	8	41315930	missense	probably damaging	1.00
R0587:Pcm1	UTSW	8	41286051	missense	probably damaging	0.99
R0635:Pcm1	UTSW	8	41267179	splice site	probably benign
R0725:Pcm1	UTSW	8	41287811	missense	probably damaging	1.00
R0762:Pcm1	UTSW	8	41261020	missense	probably damaging	1.00
R0848:Pcm1	UTSW	8	41282683	missense	probably damaging	1.00
R1027:Pcm1	UTSW	8	41293445	splice site	probably benign
R1056:Pcm1	UTSW	8	41321900	missense	probably damaging	1.00
R1534:Pcm1	UTSW	8	41287701	missense	probably benign
R1566:Pcm1	UTSW	8	41290773	missense	probably damaging	1.00
R1595:Pcm1	UTSW	8	41309635	missense	probably damaging	1.00
R1719:Pcm1	UTSW	8	41313359	missense	possibly damaging	0.62
R1816:Pcm1	UTSW	8	41309537	missense	probably damaging	0.99
R2177:Pcm1	UTSW	8	41275965	missense	probably benign
R2495:Pcm1	UTSW	8	41293579	missense	probably benign
R3737:Pcm1	UTSW	8	41261043	nonsense	probably null
R3747:Pcm1	UTSW	8	41332004	missense	probably benign	0.44
R3763:Pcm1	UTSW	8	41280077	missense	probably damaging	1.00
R3764:Pcm1	UTSW	8	41330882	missense	probably damaging	1.00
R3798:Pcm1	UTSW	8	41258014	missense	possibly damaging	0.66
R3968:Pcm1	UTSW	8	41325830	missense	probably damaging	1.00
R4760:Pcm1	UTSW	8	41287738	missense	probably damaging	0.99
R4798:Pcm1	UTSW	8	41293678	missense	probably damaging	1.00
R5062:Pcm1	UTSW	8	41259260	missense	probably damaging	0.99
R5221:Pcm1	UTSW	8	41288156	critical splice donor site	probably null
R5250:Pcm1	UTSW	8	41312205	missense	probably damaging	0.99
R5466:Pcm1	UTSW	8	41272462	critical splice donor site	probably null
R5470:Pcm1	UTSW	8	41287683	missense	probably damaging	1.00
R5958:Pcm1	UTSW	8	41328979	missense	probably damaging	1.00
R6043:Pcm1	UTSW	8	41328778	missense	possibly damaging	0.54
R6179:Pcm1	UTSW	8	41283632	missense	probably damaging	0.99
R6186:Pcm1	UTSW	8	41293793	missense	probably benign	0.23
R6227:Pcm1	UTSW	8	41330825	missense	probably damaging	0.99
R6368:Pcm1	UTSW	8	41293544	missense	probably benign	0.09
R6438:Pcm1	UTSW	8	41325381	missense	possibly damaging	0.94
R6459:Pcm1	UTSW	8	41261036	missense	probably damaging	1.00
R7399:Pcm1	UTSW	8	41293510	missense	probably benign	0.11
R7478:Pcm1	UTSW	8	41261373	missense	probably benign	0.17
R7570:Pcm1	UTSW	8	41267344	missense	possibly damaging	0.64
R7648:Pcm1	UTSW	8	41275699	missense	probably damaging	0.99
R7773:Pcm1	UTSW	8	41309573	nonsense	probably null
R7779:Pcm1	UTSW	8	41329024	missense	probably damaging	1.00
R7842:Pcm1	UTSW	8	41327584	missense	possibly damaging	0.54
R7863:Pcm1	UTSW	8	41261126	missense	probably damaging	0.99
R8169:Pcm1	UTSW	8	41310116	missense	possibly damaging	0.58
R8210:Pcm1	UTSW	8	41313937	missense	probably damaging	1.00
R8303:Pcm1	UTSW	8	41283721	missense	probably damaging	1.00
R8397:Pcm1	UTSW	8	41283579	missense	probably damaging	1.00
R8489:Pcm1	UTSW	8	41313400	missense	probably benign	0.19
R8519:Pcm1	UTSW	8	41275939	missense	probably damaging	1.00
R9136:Pcm1	UTSW	8	41279788	missense	probably benign	0.19
R9245:Pcm1	UTSW	8	41279840	missense	probably damaging	0.99
R9263:Pcm1	UTSW	8	41279753	missense	probably benign	0.00
R9406:Pcm1	UTSW	8	41275685	missense	probably damaging	0.99
R9412:Pcm1	UTSW	8	41287751	missense	probably damaging	1.00
R9541:Pcm1	UTSW	8	41327579	missense	probably benign	0.09
R9698:Pcm1	UTSW	8	41270504	missense	possibly damaging	0.95
R9716:Pcm1	UTSW	8	41275131	missense	probably damaging	0.98
R9747:Pcm1	UTSW	8	41304098	missense	probably benign	0.00
R9781:Pcm1	UTSW	8	41267361	missense	probably damaging	0.99
X0025:Pcm1	UTSW	8	41330642	missense	probably damaging	1.00
Z1177:Pcm1	UTSW	8	41274171	missense	possibly damaging	0.94
Z1177:Pcm1	UTSW	8	41287744	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TCCCATGAAGTACATACAGTTTTCC -3'
(R):5'- TGCTTCACTTAAGGAGCTACCC -3'

Sequencing Primer
(F):5'- ATATAGTCCAAGCTGCTGGC -3'
(R):5'- CCCATATAGAAGCACTGAGTAAGCTG -3'

Posted On

2019-09-13