Mutagenetix > Incidental Mutation

Incidental Mutation 'R7401:Cntn5'

574172

Institutional Source

Beutler Lab

Gene Symbol

Cntn5

Ensembl Gene

ENSMUSG00000039488

Gene Name

contactin 5

Synonyms

NB-2, LOC244683, 6720426O10Rik, A830025P08Rik

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7401 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

9660891-10904775 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 9833461 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 362 (V362I)

Ref Sequence

ENSEMBL: ENSMUSP00000124214 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000074133] [ENSMUST00000160216] [ENSMUST00000162484] [ENSMUST00000179049]

AlphaFold

P68500

Predicted Effect

probably benign
Transcript: ENSMUST00000074133
AA Change: V567I

PolyPhen 2 Score 0.220 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000073769
Gene: ENSMUSG00000039488
AA Change: V567I

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
IGc2	113	179	1.11e-10	SMART
IG	201	289	4.82e-6	SMART
IGc2	312	375	1.4e-16	SMART
IGc2	401	464	8.97e-15	SMART
IGc2	493	557	4.96e-8	SMART
IG	577	667	2.13e-7	SMART
FN3	670	756	1.01e-11	SMART
FN3	773	859	9.19e-1	SMART
FN3	875	958	3.99e-10	SMART
FN3	974	1053	1.68e-3	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000160216
AA Change: V567I

PolyPhen 2 Score 0.220 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000124327
Gene: ENSMUSG00000039488
AA Change: V567I

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
IGc2	113	179	1.11e-10	SMART
IG	201	289	4.82e-6	SMART
IGc2	312	375	1.4e-16	SMART
IGc2	401	464	8.97e-15	SMART
IGc2	493	557	4.96e-8	SMART
IG	577	667	2.13e-7	SMART
FN3	670	756	1.01e-11	SMART
FN3	773	859	9.19e-1	SMART
FN3	875	958	3.99e-10	SMART
FN3	974	1053	1.68e-3	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000162484
AA Change: V362I

PolyPhen 2 Score 0.131 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000124214
Gene: ENSMUSG00000039488
AA Change: V362I

Domain	Start	End	E-Value	Type
IG_like	10	84	1.12e2	SMART
IGc2	107	170	1.4e-16	SMART
IGc2	196	259	8.97e-15	SMART
IGc2	288	352	4.96e-8	SMART
IG	372	462	2.13e-7	SMART
FN3	465	551	1.01e-11	SMART
FN3	568	654	9.19e-1	SMART
FN3	670	753	3.99e-10	SMART
FN3	769	848	1.68e-3	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000179049
AA Change: V362I

PolyPhen 2 Score 0.131 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000135903
Gene: ENSMUSG00000039488
AA Change: V362I

Domain	Start	End	E-Value	Type
IG_like	10	84	1.12e2	SMART
IGc2	107	170	1.4e-16	SMART
IGc2	196	259	8.97e-15	SMART
IGc2	288	352	4.96e-8	SMART
IG	372	462	2.13e-7	SMART
FN3	465	551	1.01e-11	SMART
FN3	568	654	9.19e-1	SMART
FN3	670	753	3.99e-10	SMART
FN3	769	848	1.68e-3	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the immunoglobulin superfamily, and contactin family, which mediate cell surface interactions during nervous system development. This protein is a glycosylphosphatidylinositol (GPI)-anchored neuronal membrane protein that functions as a cell adhesion molecule. It may play a role in the formation of axon connections in the developing nervous system. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygous null mice are viable, fertile, and less susceptible to audiogenic seizures. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610318N02Rik	A	T	16: 17,118,404	L152Q	probably benign	Het
Abcg3	A	T	5: 104,966,774	N292K	probably damaging	Het
Adamts3	T	A	5: 89,707,450		probably null	Het
Adgrg7	T	C	16: 56,742,418	N519D	probably benign	Het
Adsl	A	G	15: 80,962,782	H263R	probably damaging	Het
Ak9	A	T	10: 41,423,004	D1567V	unknown	Het
Bscl2	T	C	19: 8,846,550	F280L	possibly damaging	Het
Cacna1b	T	A	2: 24,679,294	T873S	probably benign	Het
Cacna1c	T	C	6: 119,052,708		probably null	Het
Cast	G	T	13: 74,808,458	A18E	unknown	Het
Ccdc114	A	C	7: 45,942,765	Q323P	probably damaging	Het
Cd207	A	C	6: 83,677,848		probably benign	Het
Cd79b	A	G	11: 106,312,852	S130P	probably benign	Het
Cfap52	A	T	11: 67,949,633	N157K	probably benign	Het
Cfap57	C	T	4: 118,614,931	V84I	probably benign	Het
Chaf1b	G	T	16: 93,884,380		probably benign	Het
Cntn1	A	G	15: 92,317,989	I968V	probably benign	Het
Crem	A	G	18: 3,295,329	S80P	probably damaging	Het
Csnk1g3	C	T	18: 53,930,318	T267I	probably damaging	Het
Cyth1	A	T	11: 118,182,251	N274K	possibly damaging	Het
Dicer1	C	T	12: 104,712,278	G594S	probably benign	Het
Enpp1	C	T	10: 24,645,282	C849Y	probably damaging	Het
Fam193a	A	G	5: 34,465,635	E1189G	possibly damaging	Het
Fermt1	C	A	2: 132,917,559	V426L	probably benign	Het
Fes	A	G	7: 80,378,776		probably null	Het
Gm16486	T	C	8: 70,717,272	I1337T	probably benign	Het
Gmeb1	C	A	4: 132,225,774	L560F	probably damaging	Het
Hace1	T	C	10: 45,670,626	L452P	probably damaging	Het
Hecw2	T	A	1: 53,904,343	H975L	probably damaging	Het
Idh2	GGTCCCAG	GG	7: 80,098,329		probably benign	Het
Il1r2	T	A	1: 40,123,210	C338S	probably damaging	Het
Kcnb1	T	C	2: 167,188,284	S114G	probably damaging	Het
Lce1c	A	T	3: 92,680,316	T17S	unknown	Het
Lhfpl4	C	A	6: 113,176,666	L141F	possibly damaging	Het
Ms4a14	T	C	19: 11,302,230	E988G	possibly damaging	Het
Naip5	T	C	13: 100,219,696	Q1137R	probably benign	Het
Naip5	G	T	13: 100,219,697	Q1137K	not run	Het
Neurod1	T	A	2: 79,454,946	D31V	probably benign	Het
Neurod4	A	G	10: 130,271,058	C116R	probably damaging	Het
Nisch	A	G	14: 31,206,580	V28A	probably benign	Het
Olfr1174-ps	T	G	2: 88,311,428	M123L	probably benign	Het
Olfr1245	A	G	2: 89,575,105	V207A	probably benign	Het
Pabpc4l	A	T	3: 46,446,252	I319N	probably damaging	Het
Pabpc4l	T	A	3: 46,446,589	R207W	probably damaging	Het
Pcm1	G	A	8: 41,309,531	D1371N	probably damaging	Het
Peg10	G	GGTC	6: 4,756,452		probably benign	Het
Plxnc1	C	T	10: 94,871,005	A557T	probably benign	Het
Prkdc	T	A	16: 15,648,738	V58D	probably damaging	Het
Prpf40a	A	G	2: 53,156,947	V259A	probably benign	Het
Psmd3	A	T	11: 98,685,640	T123S	probably benign	Het
Ptgr2	G	T	12: 84,292,329		probably benign	Het
Ptprr	A	G	10: 116,048,236	H66R	probably benign	Het
Rftn2	A	G	1: 55,194,242		probably null	Het
Rsph14	T	A	10: 75,029,796	E70V	possibly damaging	Het
Slc24a5	G	A	2: 125,088,191	V471I	probably benign	Het
Sorbs1	G	C	19: 40,376,800	R180G	probably benign	Het
Spag9	A	T	11: 94,097,689	T862S	probably benign	Het
Ssbp2	T	A	13: 91,690,883	D291E	probably benign	Het
Supt5	T	C	7: 28,323,772	K329E	probably damaging	Het
Syne2	G	T	12: 75,967,381	K3115N	probably damaging	Het
Tars	A	T	15: 11,392,009	L239*	probably null	Het
Tbxa2r	T	C	10: 81,332,791	Y105H	probably benign	Het
Tesk1	T	A	4: 43,445,743	D265E	probably damaging	Het
Tril	T	C	6: 53,818,281	D652G	possibly damaging	Het
Tsga10	T	C	1: 37,834,187	R204G	probably null	Het
Twnk	A	G	19: 45,011,780	D645G	probably benign	Het
Umodl1	A	T	17: 30,998,148	D1118V	probably damaging	Het
Unc119	T	C	11: 78,347,245	I83T	probably benign	Het
Unc80	T	C	1: 66,646,415	W2233R	possibly damaging	Het
Vmn1r45	T	A	6: 89,933,434	T185S	possibly damaging	Het
Vmn2r111	G	T	17: 22,571,086	T313K	possibly damaging	Het
Wdr4	A	G	17: 31,509,832	L123S	probably damaging	Het
Zfpm2	A	G	15: 41,102,990	E957G	possibly damaging	Het

Other mutations in Cntn5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00742:Cntn5	APN	9	9976297	missense	probably damaging	0.99
IGL01118:Cntn5	APN	9	9831560	missense	possibly damaging	0.94
IGL01328:Cntn5	APN	9	9781768	missense	probably damaging	1.00
IGL01445:Cntn5	APN	9	9693484	splice site	probably benign
IGL01505:Cntn5	APN	9	9706087	missense	probably damaging	1.00
IGL01556:Cntn5	APN	9	9673908	missense	probably benign
IGL01804:Cntn5	APN	9	9831537	missense	probably damaging	0.99
IGL02173:Cntn5	APN	9	9748396	missense	probably damaging	1.00
IGL02250:Cntn5	APN	9	10145331	missense	probably damaging	1.00
IGL02366:Cntn5	APN	9	9984055	splice site	probably benign
IGL02565:Cntn5	APN	9	10145338	nonsense	probably null
IGL02593:Cntn5	APN	9	9833499	missense	probably damaging	1.00
IGL02743:Cntn5	APN	9	9984110	missense	probably damaging	1.00
IGL02976:Cntn5	APN	9	10419099	unclassified	probably benign
IGL03103:Cntn5	APN	9	9972812	splice site	probably benign
IGL03114:Cntn5	APN	9	9748452	missense	probably damaging	1.00
IGL03156:Cntn5	APN	9	9673877	missense	probably damaging	1.00
IGL02802:Cntn5	UTSW	9	10048678	splice site	probably null
R0243:Cntn5	UTSW	9	9781775	missense	probably damaging	1.00
R0385:Cntn5	UTSW	9	9972870	missense	probably damaging	1.00
R0541:Cntn5	UTSW	9	9673402	splice site	probably benign
R0827:Cntn5	UTSW	9	9666938	missense	possibly damaging	0.88
R1029:Cntn5	UTSW	9	9831572	missense	probably damaging	1.00
R1440:Cntn5	UTSW	9	10145339	missense	probably damaging	1.00
R1463:Cntn5	UTSW	9	9673796	critical splice donor site	probably null
R1536:Cntn5	UTSW	9	9976316	missense	possibly damaging	0.78
R1746:Cntn5	UTSW	9	9831572	missense	probably damaging	1.00
R1761:Cntn5	UTSW	9	10172054	missense	probably benign	0.01
R1764:Cntn5	UTSW	9	9673983	missense	probably benign
R1859:Cntn5	UTSW	9	9972834	missense	probably damaging	1.00
R1888:Cntn5	UTSW	9	9984077	missense	possibly damaging	0.95
R1888:Cntn5	UTSW	9	9984077	missense	possibly damaging	0.95
R1950:Cntn5	UTSW	9	9781769	missense	probably damaging	1.00
R2143:Cntn5	UTSW	9	9748415	missense	probably damaging	0.98
R2145:Cntn5	UTSW	9	9748415	missense	probably damaging	0.98
R2437:Cntn5	UTSW	9	10048753	nonsense	probably null
R2440:Cntn5	UTSW	9	10171955	missense	possibly damaging	0.91
R2504:Cntn5	UTSW	9	10172121	missense	probably benign
R3054:Cntn5	UTSW	9	10419071	missense	probably benign	0.30
R3056:Cntn5	UTSW	9	10419071	missense	probably benign	0.30
R3804:Cntn5	UTSW	9	9781663	splice site	probably benign
R4164:Cntn5	UTSW	9	9781676	missense	probably damaging	1.00
R4444:Cntn5	UTSW	9	9704942	missense	probably damaging	1.00
R4472:Cntn5	UTSW	9	10048771	missense	probably damaging	1.00
R4576:Cntn5	UTSW	9	9673292	missense	probably benign	0.10
R4624:Cntn5	UTSW	9	9704804	nonsense	probably null
R4652:Cntn5	UTSW	9	9704912	missense	possibly damaging	0.68
R4664:Cntn5	UTSW	9	10144209	missense	possibly damaging	0.71
R4679:Cntn5	UTSW	9	9970531	missense	probably benign	0.09
R4829:Cntn5	UTSW	9	9976283	missense	probably damaging	1.00
R4929:Cntn5	UTSW	9	9976395	critical splice acceptor site	probably null
R5211:Cntn5	UTSW	9	9704889	missense	possibly damaging	0.88
R5406:Cntn5	UTSW	9	9833460	missense	probably damaging	1.00
R5468:Cntn5	UTSW	9	9743628	missense	probably damaging	1.00
R5584:Cntn5	UTSW	9	9661452	missense	possibly damaging	0.91
R5688:Cntn5	UTSW	9	9748422	missense	probably damaging	1.00
R5762:Cntn5	UTSW	9	9748389	missense	possibly damaging	0.95
R6141:Cntn5	UTSW	9	10144157	missense	probably benign
R6147:Cntn5	UTSW	9	10012889	missense	probably damaging	0.98
R6325:Cntn5	UTSW	9	10144323	splice site	probably null
R6377:Cntn5	UTSW	9	9743652	missense	probably damaging	1.00
R6774:Cntn5	UTSW	9	10144217	missense	probably damaging	1.00
R7117:Cntn5	UTSW	9	10904699	start gained	probably benign
R7252:Cntn5	UTSW	9	9831635	missense	probably benign	0.00
R7363:Cntn5	UTSW	9	10172016	missense	probably benign	0.00
R7488:Cntn5	UTSW	9	9970565	missense	probably damaging	0.99
R7548:Cntn5	UTSW	9	9673410	splice site	probably null
R7662:Cntn5	UTSW	9	9661385	missense	probably benign	0.17
R7718:Cntn5	UTSW	9	9984128	missense	probably benign
R7719:Cntn5	UTSW	9	9704898	missense	probably damaging	1.00
R7788:Cntn5	UTSW	9	9704929	missense	probably benign	0.01
R7864:Cntn5	UTSW	9	9984177	missense	probably damaging	0.98
R7937:Cntn5	UTSW	9	9748445	missense	probably damaging	1.00
R8117:Cntn5	UTSW	9	9673950	missense	probably benign	0.33
R8159:Cntn5	UTSW	9	10145381	missense	possibly damaging	0.91
R8349:Cntn5	UTSW	9	9666835	critical splice donor site	probably null
R8449:Cntn5	UTSW	9	9666835	critical splice donor site	probably null
R8779:Cntn5	UTSW	9	10171915	missense	probably benign
R8789:Cntn5	UTSW	9	9673287	missense	probably damaging	1.00
R8985:Cntn5	UTSW	9	10171955	missense	possibly damaging	0.91
R9370:Cntn5	UTSW	9	9833515	missense	probably benign	0.19
R9382:Cntn5	UTSW	9	9673812	missense	probably benign
R9781:Cntn5	UTSW	9	10048681	critical splice donor site	probably null
Z1177:Cntn5	UTSW	9	9673962	nonsense	probably null
Z1177:Cntn5	UTSW	9	10090236	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGAGCCATTGTTCCCATTTC -3'
(R):5'- CTTCGTCAGAAGTTCTTGCCATTTAG -3'

Sequencing Primer
(F):5'- TCTGTTTCCAGTCTTTAAATGATGG -3'
(R):5'- GTTGCTTTGAATTGAAATGGGAAC -3'

Posted On

2019-09-13