Mutagenetix > Incidental Mutation

Incidental Mutation 'R7401:Ak9'

574174

Institutional Source

Beutler Lab

Gene Symbol

Ak9

Ensembl Gene

ENSMUSG00000091415

Gene Name

adenylate kinase 9

Synonyms

LOC215946, Akd1, Gm7127, Akd2

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.095) question?

Stock #

R7401 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

41303980-41434534 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 41423004 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 1567 (D1567V)

Ref Sequence

ENSEMBL: ENSMUSP00000134177 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000173494]

AlphaFold

G3UYQ4

Predicted Effect

unknown
Transcript: ENSMUST00000173494
AA Change: D1567V

SMART Domains

Protein: ENSMUSP00000134177
Gene: ENSMUSG00000091415
AA Change: D1567V

Domain	Start	End	E-Value	Type
AAA	30	330	4.65e-3	SMART
AAA	391	733	9.11e-1	SMART
Pfam:DUF3508	812	971	1.4e-7	PFAM
AAA	974	1297	1.2e-1	SMART
Blast:AAA	1326	1388	8e-18	BLAST
AAA	1393	1824	1.44e0	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the interconversion of nucleosides, possessing both nucleoside monophosphate and diphosphate kinase activities. The encoded protein uses these interconversions to maintain nucleoside homeostasis. [provided by RefSeq, Jul 2016]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610318N02Rik	A	T	16: 17,118,404	L152Q	probably benign	Het
Abcg3	A	T	5: 104,966,774	N292K	probably damaging	Het
Adamts3	T	A	5: 89,707,450		probably null	Het
Adgrg7	T	C	16: 56,742,418	N519D	probably benign	Het
Adsl	A	G	15: 80,962,782	H263R	probably damaging	Het
Bscl2	T	C	19: 8,846,550	F280L	possibly damaging	Het
Cacna1b	T	A	2: 24,679,294	T873S	probably benign	Het
Cacna1c	T	C	6: 119,052,708		probably null	Het
Cast	G	T	13: 74,808,458	A18E	unknown	Het
Ccdc114	A	C	7: 45,942,765	Q323P	probably damaging	Het
Cd207	A	C	6: 83,677,848		probably benign	Het
Cd79b	A	G	11: 106,312,852	S130P	probably benign	Het
Cfap52	A	T	11: 67,949,633	N157K	probably benign	Het
Cfap57	C	T	4: 118,614,931	V84I	probably benign	Het
Chaf1b	G	T	16: 93,884,380		probably benign	Het
Cntn1	A	G	15: 92,317,989	I968V	probably benign	Het
Cntn5	C	T	9: 9,833,461	V362I	probably benign	Het
Crem	A	G	18: 3,295,329	S80P	probably damaging	Het
Csnk1g3	C	T	18: 53,930,318	T267I	probably damaging	Het
Cyth1	A	T	11: 118,182,251	N274K	possibly damaging	Het
Dicer1	C	T	12: 104,712,278	G594S	probably benign	Het
Enpp1	C	T	10: 24,645,282	C849Y	probably damaging	Het
Fam193a	A	G	5: 34,465,635	E1189G	possibly damaging	Het
Fermt1	C	A	2: 132,917,559	V426L	probably benign	Het
Fes	A	G	7: 80,378,776		probably null	Het
Gm16486	T	C	8: 70,717,272	I1337T	probably benign	Het
Gmeb1	C	A	4: 132,225,774	L560F	probably damaging	Het
Hace1	T	C	10: 45,670,626	L452P	probably damaging	Het
Hecw2	T	A	1: 53,904,343	H975L	probably damaging	Het
Idh2	GGTCCCAG	GG	7: 80,098,329		probably benign	Het
Il1r2	T	A	1: 40,123,210	C338S	probably damaging	Het
Kcnb1	T	C	2: 167,188,284	S114G	probably damaging	Het
Lce1c	A	T	3: 92,680,316	T17S	unknown	Het
Lhfpl4	C	A	6: 113,176,666	L141F	possibly damaging	Het
Ms4a14	T	C	19: 11,302,230	E988G	possibly damaging	Het
Naip5	T	C	13: 100,219,696	Q1137R	probably benign	Het
Naip5	G	T	13: 100,219,697	Q1137K	not run	Het
Neurod1	T	A	2: 79,454,946	D31V	probably benign	Het
Neurod4	A	G	10: 130,271,058	C116R	probably damaging	Het
Nisch	A	G	14: 31,206,580	V28A	probably benign	Het
Olfr1174-ps	T	G	2: 88,311,428	M123L	probably benign	Het
Olfr1245	A	G	2: 89,575,105	V207A	probably benign	Het
Pabpc4l	A	T	3: 46,446,252	I319N	probably damaging	Het
Pabpc4l	T	A	3: 46,446,589	R207W	probably damaging	Het
Pcm1	G	A	8: 41,309,531	D1371N	probably damaging	Het
Peg10	G	GGTC	6: 4,756,452		probably benign	Het
Plxnc1	C	T	10: 94,871,005	A557T	probably benign	Het
Prkdc	T	A	16: 15,648,738	V58D	probably damaging	Het
Prpf40a	A	G	2: 53,156,947	V259A	probably benign	Het
Psmd3	A	T	11: 98,685,640	T123S	probably benign	Het
Ptgr2	G	T	12: 84,292,329		probably benign	Het
Ptprr	A	G	10: 116,048,236	H66R	probably benign	Het
Rftn2	A	G	1: 55,194,242		probably null	Het
Rsph14	T	A	10: 75,029,796	E70V	possibly damaging	Het
Slc24a5	G	A	2: 125,088,191	V471I	probably benign	Het
Sorbs1	G	C	19: 40,376,800	R180G	probably benign	Het
Spag9	A	T	11: 94,097,689	T862S	probably benign	Het
Ssbp2	T	A	13: 91,690,883	D291E	probably benign	Het
Supt5	T	C	7: 28,323,772	K329E	probably damaging	Het
Syne2	G	T	12: 75,967,381	K3115N	probably damaging	Het
Tars	A	T	15: 11,392,009	L239*	probably null	Het
Tbxa2r	T	C	10: 81,332,791	Y105H	probably benign	Het
Tesk1	T	A	4: 43,445,743	D265E	probably damaging	Het
Tril	T	C	6: 53,818,281	D652G	possibly damaging	Het
Tsga10	T	C	1: 37,834,187	R204G	probably null	Het
Twnk	A	G	19: 45,011,780	D645G	probably benign	Het
Umodl1	A	T	17: 30,998,148	D1118V	probably damaging	Het
Unc119	T	C	11: 78,347,245	I83T	probably benign	Het
Unc80	T	C	1: 66,646,415	W2233R	possibly damaging	Het
Vmn1r45	T	A	6: 89,933,434	T185S	possibly damaging	Het
Vmn2r111	G	T	17: 22,571,086	T313K	possibly damaging	Het
Wdr4	A	G	17: 31,509,832	L123S	probably damaging	Het
Zfpm2	A	G	15: 41,102,990	E957G	possibly damaging	Het

Other mutations in Ak9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
Mean	UTSW	10	41357563	missense	possibly damaging	0.59
BB006:Ak9	UTSW	10	41383948	missense
BB016:Ak9	UTSW	10	41383948	missense
R0057:Ak9	UTSW	10	41392728	missense	probably benign	0.04
R0605:Ak9	UTSW	10	41345139	missense	probably damaging	1.00
R0658:Ak9	UTSW	10	41347222	missense	probably damaging	0.98
R1696:Ak9	UTSW	10	41327589	missense	possibly damaging	0.73
R1738:Ak9	UTSW	10	41335921	missense	possibly damaging	0.86
R1815:Ak9	UTSW	10	41337576	missense	probably damaging	1.00
R2900:Ak9	UTSW	10	41424755	missense	unknown
R3123:Ak9	UTSW	10	41358580	missense	possibly damaging	0.46
R3715:Ak9	UTSW	10	41357512	missense	probably damaging	0.96
R4092:Ak9	UTSW	10	41389144	missense	probably benign	0.29
R4193:Ak9	UTSW	10	41335945	missense	probably benign	0.14
R4598:Ak9	UTSW	10	41383911	missense	probably damaging	1.00
R4621:Ak9	UTSW	10	41406891	missense	possibly damaging	0.55
R4681:Ak9	UTSW	10	41427238	missense	unknown
R4707:Ak9	UTSW	10	41345460	missense	probably benign	0.36
R4908:Ak9	UTSW	10	41420682	missense	unknown
R4952:Ak9	UTSW	10	41420589	missense	probably benign	0.07
R5162:Ak9	UTSW	10	41357657	missense	probably damaging	1.00
R5446:Ak9	UTSW	10	41420509	missense	possibly damaging	0.70
R5494:Ak9	UTSW	10	41347169	missense	probably damaging	1.00
R5517:Ak9	UTSW	10	41340891	missense	probably benign	0.23
R5849:Ak9	UTSW	10	41348049	missense	probably benign	0.31
R5858:Ak9	UTSW	10	41423027	missense	unknown
R5920:Ak9	UTSW	10	41420676	missense	probably benign	0.30
R5952:Ak9	UTSW	10	41357563	missense	possibly damaging	0.59
R5955:Ak9	UTSW	10	41358564	missense	probably damaging	1.00
R6050:Ak9	UTSW	10	41389112	missense	possibly damaging	0.74
R6087:Ak9	UTSW	10	41382832	missense	probably benign	0.01
R6190:Ak9	UTSW	10	41422407	missense	unknown
R6190:Ak9	UTSW	10	41422408	missense	unknown
R6197:Ak9	UTSW	10	41317830	missense	probably damaging	0.98
R6220:Ak9	UTSW	10	41370099	missense	unknown
R6250:Ak9	UTSW	10	41389034	missense	possibly damaging	0.54
R6315:Ak9	UTSW	10	41406841	missense	possibly damaging	0.55
R6331:Ak9	UTSW	10	41382829	missense	probably damaging	0.99
R6812:Ak9	UTSW	10	41367167	missense	unknown
R6847:Ak9	UTSW	10	41357801	splice site	probably null
R7128:Ak9	UTSW	10	41424717	missense	unknown
R7253:Ak9	UTSW	10	41432484	missense	unknown
R7286:Ak9	UTSW	10	41407371	missense
R7478:Ak9	UTSW	10	41389091	missense
R7698:Ak9	UTSW	10	41348076	missense
R7758:Ak9	UTSW	10	41347132	missense
R7806:Ak9	UTSW	10	41433084	critical splice acceptor site	probably null
R7894:Ak9	UTSW	10	41420539	missense	unknown
R7929:Ak9	UTSW	10	41383948	missense
R7941:Ak9	UTSW	10	41409137	missense	unknown
R8032:Ak9	UTSW	10	41424620	missense	unknown
R8143:Ak9	UTSW	10	41337592	nonsense	probably null
R8298:Ak9	UTSW	10	41389058	missense
R8301:Ak9	UTSW	10	41424716	missense
R8355:Ak9	UTSW	10	41399704	missense
R8703:Ak9	UTSW	10	41325124	missense
R8728:Ak9	UTSW	10	41406963	missense
R8757:Ak9	UTSW	10	41423040	missense	unknown
R8798:Ak9	UTSW	10	41382851	missense
R8868:Ak9	UTSW	10	41317846	critical splice donor site	probably null
R8868:Ak9	UTSW	10	41382873	nonsense	probably null
R9088:Ak9	UTSW	10	41406874	missense
R9090:Ak9	UTSW	10	41424627	missense	unknown
R9165:Ak9	UTSW	10	41433239	missense	unknown
R9195:Ak9	UTSW	10	41407483	missense
R9271:Ak9	UTSW	10	41424627	missense	unknown
R9297:Ak9	UTSW	10	41423085	missense	unknown
R9302:Ak9	UTSW	10	41320490	missense
R9309:Ak9	UTSW	10	41316368	critical splice donor site	probably null
R9318:Ak9	UTSW	10	41423085	missense	unknown
R9393:Ak9	UTSW	10	41409072	missense	unknown
R9541:Ak9	UTSW	10	41367177	missense
R9579:Ak9	UTSW	10	41337580	missense
R9618:Ak9	UTSW	10	41327631	missense
R9697:Ak9	UTSW	10	41422972	nonsense	probably null
R9753:Ak9	UTSW	10	41383500	missense
Z1176:Ak9	UTSW	10	41348251	missense
Z1176:Ak9	UTSW	10	41423023	missense	unknown

Predicted Primers

PCR Primer
(F):5'- TGTTGGAGCTGTGGAAACAG -3'
(R):5'- AGGATGTCCTCTGGTCTTTATACTC -3'

Sequencing Primer
(F):5'- AACAGGGTGAAGCTGTCTGTC -3'
(R):5'- CTCATATGTGTATGCTTGAACCTAC -3'

Posted On

2019-09-13