Incidental Mutation 'R7401:Hace1'
ID574175
Institutional Source Beutler Lab
Gene Symbol Hace1
Ensembl Gene ENSMUSG00000038822
Gene NameHECT domain and ankyrin repeat containing, E3 ubiquitin protein ligase 1
SynonymsA730034A22Rik, 1700042J16Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.243) question?
Stock #R7401 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location45577829-45712345 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 45670626 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 452 (L452P)
Ref Sequence ENSEMBL: ENSMUSP00000039206 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037044]
Predicted Effect probably damaging
Transcript: ENSMUST00000037044
AA Change: L452P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000039206
Gene: ENSMUSG00000038822
AA Change: L452P

DomainStartEndE-ValueType
ANK 64 93 3.23e-4 SMART
ANK 97 126 7.76e-7 SMART
ANK 130 159 8.26e-2 SMART
ANK 163 192 1.94e-7 SMART
ANK 196 227 1.65e-1 SMART
ANK 228 257 5.98e1 SMART
Blast:HECTc 372 522 7e-87 BLAST
HECTc 572 909 1.76e-138 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131406
SMART Domains Protein: ENSMUSP00000118554
Gene: ENSMUSG00000038822

DomainStartEndE-ValueType
HECTc 7 300 2.63e-96 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000150511
SMART Domains Protein: ENSMUSP00000117985
Gene: ENSMUSG00000038822

DomainStartEndE-ValueType
HECTc 55 329 1.76e-74 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a HECT domain and ankyrin repeat-containing ubiquitin ligase. The encoded protein is involved in specific tagging of target proteins, leading to their subcellular localization or proteasomal degradation. The protein is a potential tumor suppressor and is involved in the pathophysiology of several tumors, including Wilm's tumor. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a null allele exhibit increased spontaneous and induced tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610318N02Rik A T 16: 17,118,404 L152Q probably benign Het
Abcg3 A T 5: 104,966,774 N292K probably damaging Het
Adamts3 T A 5: 89,707,450 probably null Het
Adgrg7 T C 16: 56,742,418 N519D probably benign Het
Adsl A G 15: 80,962,782 H263R probably damaging Het
Ak9 A T 10: 41,423,004 D1567V unknown Het
Bscl2 T C 19: 8,846,550 F280L possibly damaging Het
Cacna1b T A 2: 24,679,294 T873S probably benign Het
Cacna1c T C 6: 119,052,708 probably null Het
Cast G T 13: 74,808,458 A18E unknown Het
Ccdc114 A C 7: 45,942,765 Q323P probably damaging Het
Cd207 A C 6: 83,677,848 probably benign Het
Cd79b A G 11: 106,312,852 S130P probably benign Het
Cfap52 A T 11: 67,949,633 N157K probably benign Het
Cfap57 C T 4: 118,614,931 V84I probably benign Het
Chaf1b G T 16: 93,884,380 probably benign Het
Cntn1 A G 15: 92,317,989 I968V probably benign Het
Cntn5 C T 9: 9,833,461 V362I probably benign Het
Crem A G 18: 3,295,329 S80P probably damaging Het
Csnk1g3 C T 18: 53,930,318 T267I probably damaging Het
Cyth1 A T 11: 118,182,251 N274K possibly damaging Het
Dicer1 C T 12: 104,712,278 G594S probably benign Het
Enpp1 C T 10: 24,645,282 C849Y probably damaging Het
Fam193a A G 5: 34,465,635 E1189G possibly damaging Het
Fermt1 C A 2: 132,917,559 V426L probably benign Het
Fes A G 7: 80,378,776 probably null Het
Gm16486 T C 8: 70,717,272 I1337T probably benign Het
Gmeb1 C A 4: 132,225,774 L560F probably damaging Het
Hecw2 T A 1: 53,904,343 H975L probably damaging Het
Idh2 GGTCCCAG GG 7: 80,098,329 probably benign Het
Il1r2 T A 1: 40,123,210 C338S probably damaging Het
Kcnb1 T C 2: 167,188,284 S114G probably damaging Het
Lce1c A T 3: 92,680,316 T17S unknown Het
Lhfpl4 C A 6: 113,176,666 L141F possibly damaging Het
Ms4a14 T C 19: 11,302,230 E988G possibly damaging Het
Naip5 T C 13: 100,219,696 Q1137R probably benign Het
Naip5 G T 13: 100,219,697 Q1137K not run Het
Neurod1 T A 2: 79,454,946 D31V probably benign Het
Neurod4 A G 10: 130,271,058 C116R probably damaging Het
Nisch A G 14: 31,206,580 V28A probably benign Het
Olfr1174-ps T G 2: 88,311,428 M123L probably benign Het
Olfr1245 A G 2: 89,575,105 V207A probably benign Het
Pabpc4l A T 3: 46,446,252 I319N probably damaging Het
Pabpc4l T A 3: 46,446,589 R207W probably damaging Het
Pcm1 G A 8: 41,309,531 D1371N probably damaging Het
Peg10 G GGTC 6: 4,756,452 probably benign Het
Plxnc1 C T 10: 94,871,005 A557T probably benign Het
Prkdc T A 16: 15,648,738 V58D probably damaging Het
Prpf40a A G 2: 53,156,947 V259A probably benign Het
Psmd3 A T 11: 98,685,640 T123S probably benign Het
Ptgr2 G T 12: 84,292,329 probably benign Het
Ptprr A G 10: 116,048,236 H66R probably benign Het
Rftn2 A G 1: 55,194,242 probably null Het
Rsph14 T A 10: 75,029,796 E70V possibly damaging Het
Slc24a5 G A 2: 125,088,191 V471I probably benign Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Spag9 A T 11: 94,097,689 T862S probably benign Het
Ssbp2 T A 13: 91,690,883 D291E probably benign Het
Supt5 T C 7: 28,323,772 K329E probably damaging Het
Syne2 G T 12: 75,967,381 K3115N probably damaging Het
Tars A T 15: 11,392,009 L239* probably null Het
Tbxa2r T C 10: 81,332,791 Y105H probably benign Het
Tesk1 T A 4: 43,445,743 D265E probably damaging Het
Tril T C 6: 53,818,281 D652G possibly damaging Het
Tsga10 T C 1: 37,834,187 R204G probably null Het
Twnk A G 19: 45,011,780 D645G probably benign Het
Umodl1 A T 17: 30,998,148 D1118V probably damaging Het
Unc119 T C 11: 78,347,245 I83T probably benign Het
Unc80 T C 1: 66,646,415 W2233R possibly damaging Het
Vmn1r45 T A 6: 89,933,434 T185S possibly damaging Het
Vmn2r111 G T 17: 22,571,086 T313K possibly damaging Het
Wdr4 A G 17: 31,509,832 L123S probably damaging Het
Zfpm2 A G 15: 41,102,990 E957G possibly damaging Het
Other mutations in Hace1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00847:Hace1 APN 10 45672357 nonsense probably null
IGL01456:Hace1 APN 10 45709998 splice site probably benign
IGL02122:Hace1 APN 10 45618604 missense probably damaging 1.00
IGL02217:Hace1 APN 10 45590375 splice site probably null
IGL02493:Hace1 APN 10 45588419 missense probably damaging 0.98
IGL02596:Hace1 APN 10 45700640 missense possibly damaging 0.55
IGL02619:Hace1 APN 10 45671434 unclassified probably benign
IGL03163:Hace1 APN 10 45672605 missense probably damaging 0.97
R0609:Hace1 UTSW 10 45648869 missense probably damaging 1.00
R0853:Hace1 UTSW 10 45648683 missense probably damaging 1.00
R2038:Hace1 UTSW 10 45700625 missense probably benign 0.03
R2212:Hace1 UTSW 10 45648675 missense possibly damaging 0.50
R2328:Hace1 UTSW 10 45648945 missense probably benign 0.43
R2881:Hace1 UTSW 10 45671134 missense probably benign 0.10
R3005:Hace1 UTSW 10 45648863 missense probably damaging 0.96
R3414:Hace1 UTSW 10 45648675 missense possibly damaging 0.50
R3930:Hace1 UTSW 10 45711508 missense probably benign 0.37
R4014:Hace1 UTSW 10 45588374 splice site probably benign
R4335:Hace1 UTSW 10 45709961 missense probably damaging 0.99
R4547:Hace1 UTSW 10 45672555 splice site probably null
R4812:Hace1 UTSW 10 45686603 missense probably benign 0.00
R4996:Hace1 UTSW 10 45649950 missense probably benign 0.17
R5858:Hace1 UTSW 10 45711525 missense possibly damaging 0.58
R5995:Hace1 UTSW 10 45670391 missense probably benign 0.00
R6049:Hace1 UTSW 10 45686662 missense probably damaging 1.00
R6111:Hace1 UTSW 10 45589510 missense possibly damaging 0.92
R6195:Hace1 UTSW 10 45670443 missense possibly damaging 0.70
R6216:Hace1 UTSW 10 45618547 missense probably benign
R6233:Hace1 UTSW 10 45670443 missense possibly damaging 0.70
R6237:Hace1 UTSW 10 45648890 missense probably benign
R6467:Hace1 UTSW 10 45590266 critical splice acceptor site probably null
R6930:Hace1 UTSW 10 45618502 missense probably damaging 1.00
R7325:Hace1 UTSW 10 45589507 nonsense probably null
R7426:Hace1 UTSW 10 45605540 missense probably damaging 1.00
R7471:Hace1 UTSW 10 45700979 missense probably benign 0.06
R7533:Hace1 UTSW 10 45711474 missense probably benign 0.03
R7661:Hace1 UTSW 10 45605553 missense probably damaging 1.00
R7873:Hace1 UTSW 10 45672787 missense possibly damaging 0.92
R7938:Hace1 UTSW 10 45686696 missense probably benign 0.11
R7995:Hace1 UTSW 10 45589492 missense probably damaging 1.00
R8017:Hace1 UTSW 10 45638382 missense probably damaging 1.00
R8019:Hace1 UTSW 10 45638382 missense probably damaging 1.00
R8022:Hace1 UTSW 10 45700970 missense probably damaging 1.00
R8292:Hace1 UTSW 10 45711461 nonsense probably null
Z1176:Hace1 UTSW 10 45686662 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCACTCATTGGATGAATGGTTAG -3'
(R):5'- CCTAAGACAAATGTGAATAGGACC -3'

Sequencing Primer
(F):5'- TCTATCTTGCTGAAACAAAAAGGCC -3'
(R):5'- AGACAAATGTGAATAGGACCTTTTAG -3'
Posted On2019-09-13