Mutagenetix > Incidental Mutation

Incidental Mutation 'R7401:Ptprr'

574179

Institutional Source

Beutler Lab

Gene Symbol

Ptprr

Ensembl Gene

ENSMUSG00000020151

Gene Name

protein tyrosine phosphatase, receptor type, R

Synonyms

PTPBR7, PTP-SL, RPTPRR

MMRRC Submission

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.283) question?

Stock #

R7401 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

116018213-116274932 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 116048236 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Arginine at position 66 (H66R)

Ref Sequence

ENSEMBL: ENSMUSP00000064392 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000063470]

AlphaFold

Q62132

Predicted Effect

probably benign
Transcript: ENSMUST00000063470
AA Change: H66R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000064392
Gene: ENSMUSG00000020151
AA Change: H66R

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
transmembrane domain	226	248	N/A	INTRINSIC
PTPc	391	648	3.74e-108	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and a single intracellular catalytic domain, and thus represents a receptor-type PTP. Silencing of this gene has been associated with colorectal cancer. Multiple transcript variants encoding different isoforms have been found for this gene. This gene shares a symbol (PTPRQ) with another gene, protein tyrosine phosphatase, receptor type, Q (GeneID 374462), which is also located on chromosome 12. [provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased ERK1/2 phosphorylation levels in cerebellar Purkinje cells, decreased grip strength, and ataxia characterized by fine motor coordination and balance defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610318N02Rik	A	T	16: 17,118,404	L152Q	probably benign	Het
Abcg3	A	T	5: 104,966,774	N292K	probably damaging	Het
Adamts3	T	A	5: 89,707,450		probably null	Het
Adgrg7	T	C	16: 56,742,418	N519D	probably benign	Het
Adsl	A	G	15: 80,962,782	H263R	probably damaging	Het
Ak9	A	T	10: 41,423,004	D1567V	unknown	Het
Bscl2	T	C	19: 8,846,550	F280L	possibly damaging	Het
Cacna1b	T	A	2: 24,679,294	T873S	probably benign	Het
Cacna1c	T	C	6: 119,052,708		probably null	Het
Cast	G	T	13: 74,808,458	A18E	unknown	Het
Ccdc114	A	C	7: 45,942,765	Q323P	probably damaging	Het
Cd207	A	C	6: 83,677,848		probably benign	Het
Cd79b	A	G	11: 106,312,852	S130P	probably benign	Het
Cfap52	A	T	11: 67,949,633	N157K	probably benign	Het
Cfap57	C	T	4: 118,614,931	V84I	probably benign	Het
Chaf1b	G	T	16: 93,884,380		probably benign	Het
Cntn1	A	G	15: 92,317,989	I968V	probably benign	Het
Cntn5	C	T	9: 9,833,461	V362I	probably benign	Het
Crem	A	G	18: 3,295,329	S80P	probably damaging	Het
Csnk1g3	C	T	18: 53,930,318	T267I	probably damaging	Het
Cyth1	A	T	11: 118,182,251	N274K	possibly damaging	Het
Dicer1	C	T	12: 104,712,278	G594S	probably benign	Het
Enpp1	C	T	10: 24,645,282	C849Y	probably damaging	Het
Fam193a	A	G	5: 34,465,635	E1189G	possibly damaging	Het
Fermt1	C	A	2: 132,917,559	V426L	probably benign	Het
Fes	A	G	7: 80,378,776		probably null	Het
Gm16486	T	C	8: 70,717,272	I1337T	probably benign	Het
Gmeb1	C	A	4: 132,225,774	L560F	probably damaging	Het
Hace1	T	C	10: 45,670,626	L452P	probably damaging	Het
Hecw2	T	A	1: 53,904,343	H975L	probably damaging	Het
Idh2	GGTCCCAG	GG	7: 80,098,329		probably benign	Het
Il1r2	T	A	1: 40,123,210	C338S	probably damaging	Het
Kcnb1	T	C	2: 167,188,284	S114G	probably damaging	Het
Lce1c	A	T	3: 92,680,316	T17S	unknown	Het
Lhfpl4	C	A	6: 113,176,666	L141F	possibly damaging	Het
Ms4a14	T	C	19: 11,302,230	E988G	possibly damaging	Het
Naip5	T	C	13: 100,219,696	Q1137R	probably benign	Het
Naip5	G	T	13: 100,219,697	Q1137K	not run	Het
Neurod1	T	A	2: 79,454,946	D31V	probably benign	Het
Neurod4	A	G	10: 130,271,058	C116R	probably damaging	Het
Nisch	A	G	14: 31,206,580	V28A	probably benign	Het
Olfr1174-ps	T	G	2: 88,311,428	M123L	probably benign	Het
Olfr1245	A	G	2: 89,575,105	V207A	probably benign	Het
Pabpc4l	A	T	3: 46,446,252	I319N	probably damaging	Het
Pabpc4l	T	A	3: 46,446,589	R207W	probably damaging	Het
Pcm1	G	A	8: 41,309,531	D1371N	probably damaging	Het
Peg10	G	GGTC	6: 4,756,452		probably benign	Het
Plxnc1	C	T	10: 94,871,005	A557T	probably benign	Het
Prkdc	T	A	16: 15,648,738	V58D	probably damaging	Het
Prpf40a	A	G	2: 53,156,947	V259A	probably benign	Het
Psmd3	A	T	11: 98,685,640	T123S	probably benign	Het
Ptgr2	G	T	12: 84,292,329		probably benign	Het
Rftn2	A	G	1: 55,194,242		probably null	Het
Rsph14	T	A	10: 75,029,796	E70V	possibly damaging	Het
Slc24a5	G	A	2: 125,088,191	V471I	probably benign	Het
Sorbs1	G	C	19: 40,376,800	R180G	probably benign	Het
Spag9	A	T	11: 94,097,689	T862S	probably benign	Het
Ssbp2	T	A	13: 91,690,883	D291E	probably benign	Het
Supt5	T	C	7: 28,323,772	K329E	probably damaging	Het
Syne2	G	T	12: 75,967,381	K3115N	probably damaging	Het
Tars	A	T	15: 11,392,009	L239*	probably null	Het
Tbxa2r	T	C	10: 81,332,791	Y105H	probably benign	Het
Tesk1	T	A	4: 43,445,743	D265E	probably damaging	Het
Tril	T	C	6: 53,818,281	D652G	possibly damaging	Het
Tsga10	T	C	1: 37,834,187	R204G	probably null	Het
Twnk	A	G	19: 45,011,780	D645G	probably benign	Het
Umodl1	A	T	17: 30,998,148	D1118V	probably damaging	Het
Unc119	T	C	11: 78,347,245	I83T	probably benign	Het
Unc80	T	C	1: 66,646,415	W2233R	possibly damaging	Het
Vmn1r45	T	A	6: 89,933,434	T185S	possibly damaging	Het
Vmn2r111	G	T	17: 22,571,086	T313K	possibly damaging	Het
Wdr4	A	G	17: 31,509,832	L123S	probably damaging	Het
Zfpm2	A	G	15: 41,102,990	E957G	possibly damaging	Het

Other mutations in Ptprr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01123:Ptprr	APN	10	116188317	missense	probably benign	0.00
IGL01762:Ptprr	APN	10	116236733	missense	probably damaging	1.00
IGL02429:Ptprr	APN	10	116273767	missense	probably damaging	0.99
IGL03396:Ptprr	APN	10	116188330	missense	probably damaging	1.00
R0268:Ptprr	UTSW	10	116252963	missense	possibly damaging	0.83
R0584:Ptprr	UTSW	10	116251158	missense	probably damaging	0.96
R1388:Ptprr	UTSW	10	116273752	missense	probably benign	0.14
R1438:Ptprr	UTSW	10	116256204	missense	probably damaging	0.98
R1533:Ptprr	UTSW	10	116188208	nonsense	probably null
R1654:Ptprr	UTSW	10	116188363	missense	probably benign	0.43
R1793:Ptprr	UTSW	10	116252922	missense	probably damaging	1.00
R4081:Ptprr	UTSW	10	116236710	missense	probably benign	0.01
R4193:Ptprr	UTSW	10	116252864	missense	probably damaging	1.00
R4254:Ptprr	UTSW	10	116162443	splice site	probably null
R4496:Ptprr	UTSW	10	116229502	missense	possibly damaging	0.91
R4799:Ptprr	UTSW	10	116048218	missense	probably benign	0.00
R5209:Ptprr	UTSW	10	116162609	missense	probably damaging	0.99
R5312:Ptprr	UTSW	10	116188419	missense	probably benign	0.28
R5410:Ptprr	UTSW	10	116188330	missense	possibly damaging	0.94
R5556:Ptprr	UTSW	10	116251149	missense	probably damaging	0.96
R5717:Ptprr	UTSW	10	116048113	missense	probably benign	0.11
R6039:Ptprr	UTSW	10	116236763	splice site	probably null
R6039:Ptprr	UTSW	10	116236763	splice site	probably null
R7013:Ptprr	UTSW	10	116236754	missense	probably damaging	1.00
R7527:Ptprr	UTSW	10	116251199	missense	probably benign	0.08
R7644:Ptprr	UTSW	10	116048228	missense	probably benign	0.00
R7651:Ptprr	UTSW	10	116251179	missense	probably benign	0.01
R7708:Ptprr	UTSW	10	116162597	missense	probably benign	0.31
R7731:Ptprr	UTSW	10	116237295	missense	probably damaging	1.00
R8026:Ptprr	UTSW	10	116048170	missense	probably damaging	1.00
R8261:Ptprr	UTSW	10	116237264	missense	possibly damaging	0.95
R8358:Ptprr	UTSW	10	116048275	missense	probably benign	0.25
R8387:Ptprr	UTSW	10	116251125	missense	probably damaging	1.00
R8894:Ptprr	UTSW	10	116048345	missense	probably benign	0.00
R9142:Ptprr	UTSW	10	116188214	missense	possibly damaging	0.90
R9375:Ptprr	UTSW	10	116273819	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- GCAGAAGATGGCCTAGTACAC -3'
(R):5'- TGCTGGCTAACTTGGTACTTAC -3'

Sequencing Primer
(F):5'- GGCCTAGTACACAAAAATATACATGC -3'
(R):5'- GGTACTTACCACCACAATCACATTTG -3'

Posted On

2019-09-13