Incidental Mutation 'R7401:Unc119'
ID 574182
Institutional Source Beutler Lab
Gene Symbol Unc119
Ensembl Gene ENSMUSG00000002058
Gene Name unc-119 lipid binding chaperone
Synonyms UNC119, Unc119h, MRG4, HRG4, Rtg4, Rg4
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7401 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 78343482-78349164 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 78347245 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 83 (I83T)
Ref Sequence ENSEMBL: ENSMUSP00000002127 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002127] [ENSMUST00000048073] [ENSMUST00000100755] [ENSMUST00000108295]
AlphaFold Q9Z2R6
Predicted Effect probably benign
Transcript: ENSMUST00000002127
AA Change: I83T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000002127
Gene: ENSMUSG00000002058
AA Change: I83T

DomainStartEndE-ValueType
low complexity region 6 13 N/A INTRINSIC
low complexity region 29 54 N/A INTRINSIC
Pfam:GMP_PDE_delta 78 237 1.6e-81 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000048073
SMART Domains Protein: ENSMUSP00000044871
Gene: ENSMUSG00000041958

DomainStartEndE-ValueType
Pfam:PIG-S 22 547 3.3e-144 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100755
AA Change: I18T

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000098318
Gene: ENSMUSG00000002058
AA Change: I18T

DomainStartEndE-ValueType
Pfam:GMP_PDE_delta 13 172 1.6e-82 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000108295
AA Change: I83T

PolyPhen 2 Score 0.522 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000103930
Gene: ENSMUSG00000002058
AA Change: I83T

DomainStartEndE-ValueType
low complexity region 6 13 N/A INTRINSIC
low complexity region 29 54 N/A INTRINSIC
Pfam:GMP_PDE_delta 80 212 1.3e-60 PFAM
Pfam:GMP_PDE_delta 218 258 1.5e-15 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is multifunctional, affecting trafficking of transducin in rod photoreceptors, interacting with src-type tyrosine kinases through SH2 and SH3 interacting domains, and aiding the uptake of bacteria through endocytosis. In addition, the encoded protein acts as a lipid-binding chaperone to help localize some myristoylated proteins correctly. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit retinal degeneration characterized by thinning of the outer nuclear layer of the retinal that is visible at 6 months and progresses rapidly after 17 to end-stage by 26 months. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610318N02Rik A T 16: 17,118,404 L152Q probably benign Het
Abcg3 A T 5: 104,966,774 N292K probably damaging Het
Adamts3 T A 5: 89,707,450 probably null Het
Adgrg7 T C 16: 56,742,418 N519D probably benign Het
Adsl A G 15: 80,962,782 H263R probably damaging Het
Ak9 A T 10: 41,423,004 D1567V unknown Het
Bscl2 T C 19: 8,846,550 F280L possibly damaging Het
Cacna1b T A 2: 24,679,294 T873S probably benign Het
Cacna1c T C 6: 119,052,708 probably null Het
Cast G T 13: 74,808,458 A18E unknown Het
Ccdc114 A C 7: 45,942,765 Q323P probably damaging Het
Cd207 A C 6: 83,677,848 probably benign Het
Cd79b A G 11: 106,312,852 S130P probably benign Het
Cfap52 A T 11: 67,949,633 N157K probably benign Het
Cfap57 C T 4: 118,614,931 V84I probably benign Het
Chaf1b G T 16: 93,884,380 probably benign Het
Cntn1 A G 15: 92,317,989 I968V probably benign Het
Cntn5 C T 9: 9,833,461 V362I probably benign Het
Crem A G 18: 3,295,329 S80P probably damaging Het
Csnk1g3 C T 18: 53,930,318 T267I probably damaging Het
Cyth1 A T 11: 118,182,251 N274K possibly damaging Het
Dicer1 C T 12: 104,712,278 G594S probably benign Het
Enpp1 C T 10: 24,645,282 C849Y probably damaging Het
Fam193a A G 5: 34,465,635 E1189G possibly damaging Het
Fermt1 C A 2: 132,917,559 V426L probably benign Het
Fes A G 7: 80,378,776 probably null Het
Gm16486 T C 8: 70,717,272 I1337T probably benign Het
Gmeb1 C A 4: 132,225,774 L560F probably damaging Het
Hace1 T C 10: 45,670,626 L452P probably damaging Het
Hecw2 T A 1: 53,904,343 H975L probably damaging Het
Idh2 GGTCCCAG GG 7: 80,098,329 probably benign Het
Il1r2 T A 1: 40,123,210 C338S probably damaging Het
Kcnb1 T C 2: 167,188,284 S114G probably damaging Het
Lce1c A T 3: 92,680,316 T17S unknown Het
Lhfpl4 C A 6: 113,176,666 L141F possibly damaging Het
Ms4a14 T C 19: 11,302,230 E988G possibly damaging Het
Naip5 T C 13: 100,219,696 Q1137R probably benign Het
Naip5 G T 13: 100,219,697 Q1137K not run Het
Neurod1 T A 2: 79,454,946 D31V probably benign Het
Neurod4 A G 10: 130,271,058 C116R probably damaging Het
Nisch A G 14: 31,206,580 V28A probably benign Het
Olfr1174-ps T G 2: 88,311,428 M123L probably benign Het
Olfr1245 A G 2: 89,575,105 V207A probably benign Het
Pabpc4l A T 3: 46,446,252 I319N probably damaging Het
Pabpc4l T A 3: 46,446,589 R207W probably damaging Het
Pcm1 G A 8: 41,309,531 D1371N probably damaging Het
Peg10 G GGTC 6: 4,756,452 probably benign Het
Plxnc1 C T 10: 94,871,005 A557T probably benign Het
Prkdc T A 16: 15,648,738 V58D probably damaging Het
Prpf40a A G 2: 53,156,947 V259A probably benign Het
Psmd3 A T 11: 98,685,640 T123S probably benign Het
Ptgr2 G T 12: 84,292,329 probably benign Het
Ptprr A G 10: 116,048,236 H66R probably benign Het
Rftn2 A G 1: 55,194,242 probably null Het
Rsph14 T A 10: 75,029,796 E70V possibly damaging Het
Slc24a5 G A 2: 125,088,191 V471I probably benign Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Spag9 A T 11: 94,097,689 T862S probably benign Het
Ssbp2 T A 13: 91,690,883 D291E probably benign Het
Supt5 T C 7: 28,323,772 K329E probably damaging Het
Syne2 G T 12: 75,967,381 K3115N probably damaging Het
Tars A T 15: 11,392,009 L239* probably null Het
Tbxa2r T C 10: 81,332,791 Y105H probably benign Het
Tesk1 T A 4: 43,445,743 D265E probably damaging Het
Tril T C 6: 53,818,281 D652G possibly damaging Het
Tsga10 T C 1: 37,834,187 R204G probably null Het
Twnk A G 19: 45,011,780 D645G probably benign Het
Umodl1 A T 17: 30,998,148 D1118V probably damaging Het
Unc80 T C 1: 66,646,415 W2233R possibly damaging Het
Vmn1r45 T A 6: 89,933,434 T185S possibly damaging Het
Vmn2r111 G T 17: 22,571,086 T313K possibly damaging Het
Wdr4 A G 17: 31,509,832 L123S probably damaging Het
Zfpm2 A G 15: 41,102,990 E957G possibly damaging Het
Other mutations in Unc119
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01155:Unc119 APN 11 78348609 missense probably damaging 1.00
IGL01317:Unc119 APN 11 78347226 missense probably damaging 0.99
IGL03164:Unc119 APN 11 78348176 missense probably damaging 1.00
R2166:Unc119 UTSW 11 78347335 splice site probably null
R4298:Unc119 UTSW 11 78348122 missense probably damaging 0.98
R5584:Unc119 UTSW 11 78348570 missense probably damaging 1.00
R6594:Unc119 UTSW 11 78347220 missense probably damaging 1.00
R7001:Unc119 UTSW 11 78348554 missense probably damaging 0.99
R7322:Unc119 UTSW 11 78348623 missense probably damaging 1.00
R7675:Unc119 UTSW 11 78343597 missense probably damaging 1.00
R8700:Unc119 UTSW 11 78347311 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- ATGACAACATGCTGTCCCCTG -3'
(R):5'- AGTATGCTAGAGTCCAAGCCTG -3'

Sequencing Primer
(F):5'- CTGCACTGTAGGTACTTTTCAAG -3'
(R):5'- AAGCCTGGACTCTGCTCTGAC -3'
Posted On 2019-09-13