Mutagenetix > Incidental Mutation

Incidental Mutation 'R7401:Spag9'

574183

Institutional Source

Beutler Lab

Gene Symbol

Spag9

Ensembl Gene

ENSMUSG00000020859

Gene Name

sperm associated antigen 9

Synonyms

syd1, JIP4, Mapk8ip4, 4733401I23Rik, JLP, 3110018C07Rik, 4831406C20Rik

MMRRC Submission

Accession Numbers

Genbank: NM_027569; MGI: 1918084

Essential gene?

Probably essential (E-score: 0.851) question?

Stock #

R7401 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

93996091-94126085 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 94097689 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 862 (T862S)

Ref Sequence

ENSEMBL: ENSMUSP00000042271 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024979] [ENSMUST00000041956] [ENSMUST00000075695] [ENSMUST00000092777] [ENSMUST00000103168] [ENSMUST00000132079] [ENSMUST00000153076]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000024979
AA Change: T724S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000024979
Gene: ENSMUSG00000020859
AA Change: T724S

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
PDB:2W83\|D	253	305	1e-25	PDB
low complexity region	306	339	N/A	INTRINSIC
coiled coil region	572	606	N/A	INTRINSIC
low complexity region	735	751	N/A	INTRINSIC
SCOP:d1kb0a2	823	969	3e-5	SMART
Blast:WD40	924	964	8e-18	BLAST
low complexity region	1132	1150	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000041956
AA Change: T862S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000042271
Gene: ENSMUSG00000020859
AA Change: T862S

Domain	Start	End	E-Value	Type
Pfam:Jnk-SapK_ap_N	24	179	2e-61	PFAM
Pfam:JIP_LZII	390	460	5.3e-32	PFAM
coiled coil region	710	744	N/A	INTRINSIC
low complexity region	873	889	N/A	INTRINSIC
SCOP:d1kb0a2	961	1107	1e-5	SMART
Blast:WD40	1062	1102	1e-17	BLAST
low complexity region	1270	1288	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000075695
AA Change: T723S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000075115
Gene: ENSMUSG00000020859
AA Change: T723S

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
PDB:2W83\|D	253	305	1e-25	PDB
low complexity region	306	339	N/A	INTRINSIC
coiled coil region	571	605	N/A	INTRINSIC
low complexity region	734	750	N/A	INTRINSIC
SCOP:d1kb0a2	822	968	3e-5	SMART
Blast:WD40	923	963	7e-18	BLAST
low complexity region	1131	1149	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000092777
AA Change: T724S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000090452
Gene: ENSMUSG00000020859
AA Change: T724S

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
PDB:2W83\|D	254	306	1e-25	PDB
low complexity region	307	340	N/A	INTRINSIC
coiled coil region	572	606	N/A	INTRINSIC
low complexity region	735	751	N/A	INTRINSIC
SCOP:d1kb0a2	823	969	3e-5	SMART
Blast:WD40	924	964	7e-18	BLAST
low complexity region	1132	1150	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000103168
AA Change: T719S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000099457
Gene: ENSMUSG00000020859
AA Change: T719S

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
PDB:2W83\|D	249	301	1e-25	PDB
low complexity region	302	335	N/A	INTRINSIC
coiled coil region	567	601	N/A	INTRINSIC
low complexity region	730	746	N/A	INTRINSIC
SCOP:d1kb0a2	818	964	3e-5	SMART
Blast:WD40	919	959	8e-18	BLAST
low complexity region	1127	1145	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000132079
AA Change: T512S

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000118850
Gene: ENSMUSG00000020859
AA Change: T512S

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
coiled coil region	360	394	N/A	INTRINSIC
low complexity region	523	539	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000153076
AA Change: T443S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000117502
Gene: ENSMUSG00000020859
AA Change: T443S

Domain	Start	End	E-Value	Type
PDB:2W83\|D	1	25	4e-8	PDB
low complexity region	26	59	N/A	INTRINSIC
coiled coil region	291	325	N/A	INTRINSIC
low complexity region	454	470	N/A	INTRINSIC
SCOP:d1kb0a2	542	688	3e-5	SMART
Blast:WD40	643	683	1e-17	BLAST
low complexity region	864	882	N/A	INTRINSIC

Predicted Effect

SMART Domains

Protein: ENSMUSP00000115864
Gene: ENSMUSG00000020859
AA Change: T711S

Domain	Start	End	E-Value	Type
Pfam:JIP_LZII	240	310	1.1e-32	PFAM
coiled coil region	559	593	N/A	INTRINSIC
low complexity region	723	739	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cancer testis antigen gene family. The encoded protein functions as a scaffold protein that structurally organizes mitogen-activated protein kinases and mediates c-Jun-terminal kinase signaling. This protein also binds to kinesin-1 and may be involved in microtubule-based membrane transport. This protein may play a role in tumor growth and development. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2011]
PHENOTYPE: Male mice homozygous for a null mutation display reduced fertility with oligoasthenozoospermia. [provided by MGI curators]

Allele List at MGI

All alleles(5) : Targeted, knock-out(1) Gene trapped(4)

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610318N02Rik	A	T	16: 17,118,404	L152Q	probably benign	Het
Abcg3	A	T	5: 104,966,774	N292K	probably damaging	Het
Adamts3	T	A	5: 89,707,450		probably null	Het
Adgrg7	T	C	16: 56,742,418	N519D	probably benign	Het
Adsl	A	G	15: 80,962,782	H263R	probably damaging	Het
Ak9	A	T	10: 41,423,004	D1567V	unknown	Het
Bscl2	T	C	19: 8,846,550	F280L	possibly damaging	Het
Cacna1b	T	A	2: 24,679,294	T873S	probably benign	Het
Cacna1c	T	C	6: 119,052,708		probably null	Het
Cast	G	T	13: 74,808,458	A18E	unknown	Het
Ccdc114	A	C	7: 45,942,765	Q323P	probably damaging	Het
Cd207	A	C	6: 83,677,848		probably benign	Het
Cd79b	A	G	11: 106,312,852	S130P	probably benign	Het
Cfap52	A	T	11: 67,949,633	N157K	probably benign	Het
Cfap57	C	T	4: 118,614,931	V84I	probably benign	Het
Chaf1b	G	T	16: 93,884,380		probably benign	Het
Cntn1	A	G	15: 92,317,989	I968V	probably benign	Het
Cntn5	C	T	9: 9,833,461	V362I	probably benign	Het
Crem	A	G	18: 3,295,329	S80P	probably damaging	Het
Csnk1g3	C	T	18: 53,930,318	T267I	probably damaging	Het
Cyth1	A	T	11: 118,182,251	N274K	possibly damaging	Het
Dicer1	C	T	12: 104,712,278	G594S	probably benign	Het
Enpp1	C	T	10: 24,645,282	C849Y	probably damaging	Het
Fam193a	A	G	5: 34,465,635	E1189G	possibly damaging	Het
Fermt1	C	A	2: 132,917,559	V426L	probably benign	Het
Fes	A	G	7: 80,378,776		probably null	Het
Gm16486	T	C	8: 70,717,272	I1337T	probably benign	Het
Gmeb1	C	A	4: 132,225,774	L560F	probably damaging	Het
Hace1	T	C	10: 45,670,626	L452P	probably damaging	Het
Hecw2	T	A	1: 53,904,343	H975L	probably damaging	Het
Idh2	GGTCCCAG	GG	7: 80,098,329		probably benign	Het
Il1r2	T	A	1: 40,123,210	C338S	probably damaging	Het
Kcnb1	T	C	2: 167,188,284	S114G	probably damaging	Het
Lce1c	A	T	3: 92,680,316	T17S	unknown	Het
Lhfpl4	C	A	6: 113,176,666	L141F	possibly damaging	Het
Ms4a14	T	C	19: 11,302,230	E988G	possibly damaging	Het
Naip5	T	C	13: 100,219,696	Q1137R	probably benign	Het
Naip5	G	T	13: 100,219,697	Q1137K	not run	Het
Neurod1	T	A	2: 79,454,946	D31V	probably benign	Het
Neurod4	A	G	10: 130,271,058	C116R	probably damaging	Het
Nisch	A	G	14: 31,206,580	V28A	probably benign	Het
Olfr1174-ps	T	G	2: 88,311,428	M123L	probably benign	Het
Olfr1245	A	G	2: 89,575,105	V207A	probably benign	Het
Pabpc4l	A	T	3: 46,446,252	I319N	probably damaging	Het
Pabpc4l	T	A	3: 46,446,589	R207W	probably damaging	Het
Pcm1	G	A	8: 41,309,531	D1371N	probably damaging	Het
Peg10	G	GGTC	6: 4,756,452		probably benign	Het
Plxnc1	C	T	10: 94,871,005	A557T	probably benign	Het
Prkdc	T	A	16: 15,648,738	V58D	probably damaging	Het
Prpf40a	A	G	2: 53,156,947	V259A	probably benign	Het
Psmd3	A	T	11: 98,685,640	T123S	probably benign	Het
Ptgr2	G	T	12: 84,292,329		probably benign	Het
Ptprr	A	G	10: 116,048,236	H66R	probably benign	Het
Rftn2	A	G	1: 55,194,242		probably null	Het
Rsph14	T	A	10: 75,029,796	E70V	possibly damaging	Het
Slc24a5	G	A	2: 125,088,191	V471I	probably benign	Het
Sorbs1	G	C	19: 40,376,800	R180G	probably benign	Het
Ssbp2	T	A	13: 91,690,883	D291E	probably benign	Het
Supt5	T	C	7: 28,323,772	K329E	probably damaging	Het
Syne2	G	T	12: 75,967,381	K3115N	probably damaging	Het
Tars	A	T	15: 11,392,009	L239*	probably null	Het
Tbxa2r	T	C	10: 81,332,791	Y105H	probably benign	Het
Tesk1	T	A	4: 43,445,743	D265E	probably damaging	Het
Tril	T	C	6: 53,818,281	D652G	possibly damaging	Het
Tsga10	T	C	1: 37,834,187	R204G	probably null	Het
Twnk	A	G	19: 45,011,780	D645G	probably benign	Het
Umodl1	A	T	17: 30,998,148	D1118V	probably damaging	Het
Unc119	T	C	11: 78,347,245	I83T	probably benign	Het
Unc80	T	C	1: 66,646,415	W2233R	possibly damaging	Het
Vmn1r45	T	A	6: 89,933,434	T185S	possibly damaging	Het
Vmn2r111	G	T	17: 22,571,086	T313K	possibly damaging	Het
Wdr4	A	G	17: 31,509,832	L123S	probably damaging	Het
Zfpm2	A	G	15: 41,102,990	E957G	possibly damaging	Het

Other mutations in Spag9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00422:Spag9	APN	11	94097866	missense	probably benign	0.02
IGL01776:Spag9	APN	11	94116727	splice site	probably benign
IGL02095:Spag9	APN	11	94108582	missense	probably damaging	1.00
IGL02307:Spag9	APN	11	94102160	critical splice donor site	probably null
IGL02417:Spag9	APN	11	94116741	missense	probably benign	0.27
IGL02480:Spag9	APN	11	94108587	nonsense	probably null
IGL02864:Spag9	APN	11	94106661	missense	probably damaging	1.00
IGL02976:Spag9	APN	11	94083953	missense	probably benign	0.30
IGL02979:Spag9	APN	11	94097364	missense	probably benign
IGL03349:Spag9	APN	11	94093509	missense	possibly damaging	0.51
dazzle	UTSW	11	94093624	nonsense	probably null
R0128:Spag9	UTSW	11	94093539	missense	probably damaging	1.00
R0418:Spag9	UTSW	11	94091753	splice site	probably benign
R1463:Spag9	UTSW	11	94116837	missense	probably damaging	1.00
R1593:Spag9	UTSW	11	94097233	missense	probably damaging	1.00
R1605:Spag9	UTSW	11	94048539	missense	probably damaging	0.99
R1649:Spag9	UTSW	11	94108452	splice site	probably null
R1697:Spag9	UTSW	11	93996565	missense	probably benign	0.00
R1952:Spag9	UTSW	11	94097358	missense	possibly damaging	0.77
R2011:Spag9	UTSW	11	94092375	nonsense	probably null
R2012:Spag9	UTSW	11	94092375	nonsense	probably null
R2351:Spag9	UTSW	11	94092900	missense	probably damaging	1.00
R2367:Spag9	UTSW	11	94116757	missense	probably damaging	1.00
R3027:Spag9	UTSW	11	94086377	missense	probably null	1.00
R3766:Spag9	UTSW	11	94060283	intron	probably benign
R3777:Spag9	UTSW	11	94099026	critical splice acceptor site	probably null
R3937:Spag9	UTSW	11	94044417	missense	possibly damaging	0.94
R3937:Spag9	UTSW	11	94044479	missense	possibly damaging	0.92
R4417:Spag9	UTSW	11	94060346	intron	probably benign
R4445:Spag9	UTSW	11	94097253	missense	possibly damaging	0.95
R4711:Spag9	UTSW	11	94114351	critical splice donor site	probably null
R4799:Spag9	UTSW	11	94048516	missense	possibly damaging	0.87
R4799:Spag9	UTSW	11	94048517	missense	probably damaging	0.96
R4816:Spag9	UTSW	11	94048599	intron	probably benign
R4843:Spag9	UTSW	11	94097818	missense	probably damaging	1.00
R5020:Spag9	UTSW	11	94097786	missense	probably benign	0.08
R5119:Spag9	UTSW	11	94122722	missense	probably damaging	1.00
R5298:Spag9	UTSW	11	94100135	missense	probably damaging	1.00
R5304:Spag9	UTSW	11	94069012	missense	probably damaging	1.00
R5305:Spag9	UTSW	11	94069012	missense	probably damaging	1.00
R5395:Spag9	UTSW	11	94091751	splice site	probably null
R5636:Spag9	UTSW	11	94069012	missense	probably damaging	1.00
R5638:Spag9	UTSW	11	94069012	missense	probably damaging	1.00
R5654:Spag9	UTSW	11	94090712	missense	probably damaging	1.00
R5779:Spag9	UTSW	11	94114253	missense	probably benign	0.20
R5814:Spag9	UTSW	11	94082828	missense	possibly damaging	0.94
R5912:Spag9	UTSW	11	94044425	missense	probably damaging	0.98
R6038:Spag9	UTSW	11	94112092	missense	probably damaging	1.00
R6038:Spag9	UTSW	11	94112092	missense	probably damaging	1.00
R6269:Spag9	UTSW	11	94044507	missense	probably benign	0.05
R6294:Spag9	UTSW	11	94093485	critical splice acceptor site	probably null
R6389:Spag9	UTSW	11	94086311	missense	probably damaging	1.00
R6420:Spag9	UTSW	11	94086302	missense	probably damaging	1.00
R6460:Spag9	UTSW	11	94068975	missense	probably damaging	1.00
R6482:Spag9	UTSW	11	94093502	missense	possibly damaging	0.94
R6860:Spag9	UTSW	11	94081370	missense	probably benign	0.25
R7086:Spag9	UTSW	11	94097864	missense	probably benign
R7179:Spag9	UTSW	11	94089432	splice site	probably null
R7225:Spag9	UTSW	11	94097358	missense	probably damaging	0.98
R7351:Spag9	UTSW	11	94092976	missense	probably benign	0.00
R7366:Spag9	UTSW	11	94108521	missense	possibly damaging	0.56
R7378:Spag9	UTSW	11	94114351	critical splice donor site	probably null
R7506:Spag9	UTSW	11	94108464	missense	probably damaging	1.00
R7507:Spag9	UTSW	11	94068080	missense	probably benign	0.00
R7513:Spag9	UTSW	11	94112083	missense	probably damaging	1.00
R7655:Spag9	UTSW	11	93996563	missense	possibly damaging	0.56
R7656:Spag9	UTSW	11	93996563	missense	possibly damaging	0.56
R7664:Spag9	UTSW	11	94102160	critical splice donor site	probably null
R7665:Spag9	UTSW	11	94013654	missense	probably damaging	0.98
R7862:Spag9	UTSW	11	94112066	missense	possibly damaging	0.69
R8074:Spag9	UTSW	11	94112051	missense	probably damaging	1.00
R8085:Spag9	UTSW	11	94099044	missense	probably benign
R8469:Spag9	UTSW	11	94091801	missense	probably damaging	1.00
R8547:Spag9	UTSW	11	94122821	missense	possibly damaging	0.84
R8709:Spag9	UTSW	11	94068090	missense	probably benign	0.02
R8732:Spag9	UTSW	11	94071688	critical splice donor site	probably null
R8899:Spag9	UTSW	11	94092869	missense	probably damaging	1.00
R8983:Spag9	UTSW	11	94067989	missense	probably benign
R9043:Spag9	UTSW	11	94060259	missense
R9050:Spag9	UTSW	11	94044468	missense	probably damaging	0.97
R9502:Spag9	UTSW	11	94068966	missense	probably damaging	1.00
R9575:Spag9	UTSW	11	94071583	missense	probably damaging	0.99
R9667:Spag9	UTSW	11	93996293	missense	possibly damaging	0.83
R9683:Spag9	UTSW	11	94097742	missense	probably damaging	1.00
R9774:Spag9	UTSW	11	94114236	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- AGAGTGCCACATTACAGACTTGTC -3'
(R):5'- AACACTGGGGAGAGGTCTTC -3'

Sequencing Primer
(F):5'- GTCAATCTTAAAGTAGCCAAGGTG -3'
(R):5'- TCTGGGATCTGAACTCCCAGTG -3'

Posted On

2019-09-13