Incidental Mutation 'R7401:Cyth1'
ID 574186
Institutional Source Beutler Lab
Gene Symbol Cyth1
Ensembl Gene ENSMUSG00000017132
Gene Name cytohesin 1
Synonyms CLM1, Pscd1, CTH-1
MMRRC Submission 045483-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.094) question?
Stock # R7401 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 118054996-118139452 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 118073077 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 274 (N274K)
Ref Sequence ENSEMBL: ENSMUSP00000097756 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017276] [ENSMUST00000100181] [ENSMUST00000106302] [ENSMUST00000106305] [ENSMUST00000151165]
AlphaFold Q9QX11
Predicted Effect probably damaging
Transcript: ENSMUST00000017276
AA Change: N260K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000017276
Gene: ENSMUSG00000017132
AA Change: N260K

DomainStartEndE-ValueType
Sec7 59 244 1.38e-108 SMART
PH 261 378 4.8e-25 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000100181
AA Change: N274K

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000097756
Gene: ENSMUSG00000017132
AA Change: N274K

DomainStartEndE-ValueType
Sec7 73 258 1.38e-108 SMART
PH 275 392 1.65e-23 SMART
low complexity region 402 425 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000106302
AA Change: N262K

PolyPhen 2 Score 0.850 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000101909
Gene: ENSMUSG00000017132
AA Change: N262K

DomainStartEndE-ValueType
Sec7 61 246 1.38e-108 SMART
PH 263 381 4.18e-25 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000106305
AA Change: N260K

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000101912
Gene: ENSMUSG00000017132
AA Change: N260K

DomainStartEndE-ValueType
Sec7 59 244 1.38e-108 SMART
PH 261 379 4.18e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000151165
SMART Domains Protein: ENSMUSP00000114792
Gene: ENSMUSG00000017132

DomainStartEndE-ValueType
SCOP:d1pbv__ 55 99 4e-15 SMART
PDB:1BC9|A 60 99 9e-21 PDB
Blast:Sec7 61 99 1e-20 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the PSCD family. Members of this family have identical structural organization that consists of an N-terminal coiled-coil motif, a central Sec7 domain, and a C-terminal pleckstrin homology (PH) domain. The coiled-coil motif is involved in homodimerization, the Sec7 domain contains guanine-nucleotide exchange protein activity, and the PH domain interacts with phospholipids and is responsible for association of PSCDs with membranes. Members of this family appear to mediate the regulation of protein sorting and membrane trafficking. This gene is highly expressed in natural killer and peripheral T cells, and regulates the adhesiveness of integrins at the plasma membrane of lymphocytes. A pseudogene of this gene has been defined on the X chromosome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit normal brain morphology and long term potentiation. Mice homozygous for a knock-out allele exhibit decreased myelin sheath thickness due to hypomyelination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610318N02Rik A T 16: 16,936,268 (GRCm39) L152Q probably benign Het
Abcg3 A T 5: 105,114,640 (GRCm39) N292K probably damaging Het
Adamts3 T A 5: 89,855,309 (GRCm39) probably null Het
Adgrg7 T C 16: 56,562,781 (GRCm39) N519D probably benign Het
Adsl A G 15: 80,846,983 (GRCm39) H263R probably damaging Het
Ak9 A T 10: 41,299,000 (GRCm39) D1567V unknown Het
Bscl2 T C 19: 8,823,914 (GRCm39) F280L possibly damaging Het
Cacna1b T A 2: 24,569,306 (GRCm39) T873S probably benign Het
Cacna1c T C 6: 119,029,669 (GRCm39) probably null Het
Cast G T 13: 74,956,577 (GRCm39) A18E unknown Het
Cd207 A C 6: 83,654,830 (GRCm39) probably benign Het
Cd79b A G 11: 106,203,678 (GRCm39) S130P probably benign Het
Cfap52 A T 11: 67,840,459 (GRCm39) N157K probably benign Het
Cfap57 C T 4: 118,472,128 (GRCm39) V84I probably benign Het
Chaf1b G T 16: 93,681,268 (GRCm39) probably benign Het
Cntn1 A G 15: 92,215,870 (GRCm39) I968V probably benign Het
Cntn5 C T 9: 9,833,466 (GRCm39) V362I probably benign Het
Crem A G 18: 3,295,329 (GRCm39) S80P probably damaging Het
Csnk1g3 C T 18: 54,063,390 (GRCm39) T267I probably damaging Het
Dicer1 C T 12: 104,678,537 (GRCm39) G594S probably benign Het
Enpp1 C T 10: 24,521,180 (GRCm39) C849Y probably damaging Het
Fam193a A G 5: 34,622,979 (GRCm39) E1189G possibly damaging Het
Fermt1 C A 2: 132,759,479 (GRCm39) V426L probably benign Het
Fes A G 7: 80,028,524 (GRCm39) probably null Het
Gmeb1 C A 4: 131,953,085 (GRCm39) L560F probably damaging Het
Hace1 T C 10: 45,546,722 (GRCm39) L452P probably damaging Het
Hecw2 T A 1: 53,943,502 (GRCm39) H975L probably damaging Het
Idh2 GGTCCCAG GG 7: 79,748,077 (GRCm39) probably benign Het
Il1r2 T A 1: 40,162,370 (GRCm39) C338S probably damaging Het
Iqcn T C 8: 71,169,921 (GRCm39) I1337T probably benign Het
Kcnb1 T C 2: 167,030,204 (GRCm39) S114G probably damaging Het
Lce1c A T 3: 92,587,623 (GRCm39) T17S unknown Het
Lhfpl4 C A 6: 113,153,627 (GRCm39) L141F possibly damaging Het
Ms4a14 T C 19: 11,279,594 (GRCm39) E988G possibly damaging Het
Naip5 T C 13: 100,356,204 (GRCm39) Q1137R probably benign Het
Naip5 G T 13: 100,356,205 (GRCm39) Q1137K not run Het
Neurod1 T A 2: 79,285,290 (GRCm39) D31V probably benign Het
Neurod4 A G 10: 130,106,927 (GRCm39) C116R probably damaging Het
Nisch A G 14: 30,928,537 (GRCm39) V28A probably benign Het
Odad1 A C 7: 45,592,189 (GRCm39) Q323P probably damaging Het
Or4a72 A G 2: 89,405,449 (GRCm39) V207A probably benign Het
Or5d44 T G 2: 88,141,772 (GRCm39) M123L probably benign Het
Pabpc4l T A 3: 46,401,024 (GRCm39) R207W probably damaging Het
Pabpc4l A T 3: 46,400,687 (GRCm39) I319N probably damaging Het
Pcm1 G A 8: 41,762,568 (GRCm39) D1371N probably damaging Het
Peg10 G GGTC 6: 4,756,452 (GRCm39) probably benign Het
Plxnc1 C T 10: 94,706,867 (GRCm39) A557T probably benign Het
Prkdc T A 16: 15,466,602 (GRCm39) V58D probably damaging Het
Prpf40a A G 2: 53,046,959 (GRCm39) V259A probably benign Het
Psmd3 A T 11: 98,576,466 (GRCm39) T123S probably benign Het
Ptgr2 G T 12: 84,339,103 (GRCm39) probably benign Het
Ptprr A G 10: 115,884,141 (GRCm39) H66R probably benign Het
Rftn2 A G 1: 55,233,401 (GRCm39) probably null Het
Rsph14 T A 10: 74,865,628 (GRCm39) E70V possibly damaging Het
Slc24a5 G A 2: 124,930,111 (GRCm39) V471I probably benign Het
Sorbs1 G C 19: 40,365,244 (GRCm39) R180G probably benign Het
Spag9 A T 11: 93,988,515 (GRCm39) T862S probably benign Het
Ssbp2 T A 13: 91,839,002 (GRCm39) D291E probably benign Het
Supt5 T C 7: 28,023,197 (GRCm39) K329E probably damaging Het
Syne2 G T 12: 76,014,155 (GRCm39) K3115N probably damaging Het
Tars1 A T 15: 11,392,095 (GRCm39) L239* probably null Het
Tbxa2r T C 10: 81,168,625 (GRCm39) Y105H probably benign Het
Tesk1 T A 4: 43,445,743 (GRCm39) D265E probably damaging Het
Tril T C 6: 53,795,266 (GRCm39) D652G possibly damaging Het
Tsga10 T C 1: 37,873,268 (GRCm39) R204G probably null Het
Twnk A G 19: 45,000,219 (GRCm39) D645G probably benign Het
Umodl1 A T 17: 31,217,122 (GRCm39) D1118V probably damaging Het
Unc119 T C 11: 78,238,071 (GRCm39) I83T probably benign Het
Unc80 T C 1: 66,685,574 (GRCm39) W2233R possibly damaging Het
Vmn1r45 T A 6: 89,910,416 (GRCm39) T185S possibly damaging Het
Vmn2r111 G T 17: 22,790,067 (GRCm39) T313K possibly damaging Het
Wdr4 A G 17: 31,728,806 (GRCm39) L123S probably damaging Het
Zfpm2 A G 15: 40,966,386 (GRCm39) E957G possibly damaging Het
Other mutations in Cyth1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01327:Cyth1 APN 11 118,084,439 (GRCm39) critical splice donor site probably null
IGL02047:Cyth1 APN 11 118,059,958 (GRCm39) missense probably damaging 1.00
IGL02658:Cyth1 APN 11 118,073,072 (GRCm39) missense probably damaging 0.99
IGL02826:Cyth1 APN 11 118,076,307 (GRCm39) missense possibly damaging 0.89
Mucilage UTSW 11 118,061,686 (GRCm39) missense probably damaging 1.00
Stuck UTSW 11 118,076,585 (GRCm39) critical splice donor site probably null
tarred UTSW 11 118,074,749 (GRCm39) nonsense probably null
R0109:Cyth1 UTSW 11 118,073,132 (GRCm39) missense probably damaging 0.98
R0109:Cyth1 UTSW 11 118,073,132 (GRCm39) missense probably damaging 0.98
R0470:Cyth1 UTSW 11 118,023,074 (GRCm39) unclassified probably benign
R1387:Cyth1 UTSW 11 118,073,172 (GRCm39) unclassified probably benign
R1599:Cyth1 UTSW 11 118,068,047 (GRCm39) missense probably damaging 0.99
R2098:Cyth1 UTSW 11 118,084,479 (GRCm39) missense probably damaging 1.00
R2156:Cyth1 UTSW 11 118,073,634 (GRCm39) missense probably damaging 1.00
R3546:Cyth1 UTSW 11 118,083,262 (GRCm39) missense probably damaging 0.96
R4300:Cyth1 UTSW 11 118,074,720 (GRCm39) missense probably damaging 0.98
R4589:Cyth1 UTSW 11 118,075,811 (GRCm39) missense possibly damaging 0.70
R4799:Cyth1 UTSW 11 118,074,768 (GRCm39) missense probably damaging 1.00
R5165:Cyth1 UTSW 11 118,059,908 (GRCm39) missense possibly damaging 0.82
R5524:Cyth1 UTSW 11 118,073,593 (GRCm39) missense probably benign 0.27
R5834:Cyth1 UTSW 11 118,083,289 (GRCm39) critical splice acceptor site probably null
R5933:Cyth1 UTSW 11 118,076,585 (GRCm39) critical splice donor site probably null
R5960:Cyth1 UTSW 11 118,023,193 (GRCm39) unclassified probably benign
R6609:Cyth1 UTSW 11 118,061,686 (GRCm39) missense probably damaging 1.00
R7014:Cyth1 UTSW 11 118,103,477 (GRCm39) missense probably benign
R7108:Cyth1 UTSW 11 118,073,739 (GRCm39) missense probably damaging 0.99
R7237:Cyth1 UTSW 11 118,076,321 (GRCm39) missense probably damaging 1.00
R7424:Cyth1 UTSW 11 118,074,835 (GRCm39) splice site probably null
R7523:Cyth1 UTSW 11 118,074,749 (GRCm39) nonsense probably null
R7574:Cyth1 UTSW 11 118,073,689 (GRCm39) missense probably damaging 1.00
R7647:Cyth1 UTSW 11 118,068,114 (GRCm39) missense probably benign 0.00
R7731:Cyth1 UTSW 11 118,059,879 (GRCm39) missense possibly damaging 0.55
R7848:Cyth1 UTSW 11 118,074,749 (GRCm39) nonsense probably null
R7849:Cyth1 UTSW 11 118,074,749 (GRCm39) nonsense probably null
R8755:Cyth1 UTSW 11 118,074,768 (GRCm39) missense probably benign 0.31
R8781:Cyth1 UTSW 11 118,073,069 (GRCm39) missense probably damaging 0.98
R9045:Cyth1 UTSW 11 118,073,090 (GRCm39) missense possibly damaging 0.72
R9062:Cyth1 UTSW 11 118,023,142 (GRCm39) missense unknown
R9299:Cyth1 UTSW 11 118,059,837 (GRCm39) splice site probably benign
R9393:Cyth1 UTSW 11 118,074,710 (GRCm39) missense probably benign 0.28
R9476:Cyth1 UTSW 11 118,076,206 (GRCm39) critical splice donor site probably null
R9510:Cyth1 UTSW 11 118,076,206 (GRCm39) critical splice donor site probably null
X0063:Cyth1 UTSW 11 118,023,155 (GRCm39) unclassified probably benign
Predicted Primers PCR Primer
(F):5'- AGAGTCTGTGTCCAGGAGTCTG -3'
(R):5'- AGCAGAGAATGGCCATGTTC -3'

Sequencing Primer
(F):5'- CCAGGAGTCTGTTCTGTGGTGAC -3'
(R):5'- AGCAGAGAATGGCCATGTTCTTTTC -3'
Posted On 2019-09-13