Mutagenetix > Incidental Mutation

Incidental Mutation 'R7401:Cyth1'

574186

Institutional Source

Beutler Lab

Gene Symbol

Cyth1

Ensembl Gene

ENSMUSG00000017132

Gene Name

cytohesin 1

Synonyms

CTH-1, Pscd1, CLM1

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.107) question?

Stock #

R7401 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

118132019-118248592 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 118182251 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 274 (N274K)

Ref Sequence

ENSEMBL: ENSMUSP00000097756 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000017276] [ENSMUST00000100181] [ENSMUST00000106302] [ENSMUST00000106305] [ENSMUST00000151165]

AlphaFold

Q9QX11

Predicted Effect

probably damaging
Transcript: ENSMUST00000017276
AA Change: N260K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000017276
Gene: ENSMUSG00000017132
AA Change: N260K

Domain	Start	End	E-Value	Type
Sec7	59	244	1.38e-108	SMART
PH	261	378	4.8e-25	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000100181
AA Change: N274K

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000097756
Gene: ENSMUSG00000017132
AA Change: N274K

Domain	Start	End	E-Value	Type
Sec7	73	258	1.38e-108	SMART
PH	275	392	1.65e-23	SMART
low complexity region	402	425	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000106302
AA Change: N262K

PolyPhen 2 Score 0.850 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000101909
Gene: ENSMUSG00000017132
AA Change: N262K

Domain	Start	End	E-Value	Type
Sec7	61	246	1.38e-108	SMART
PH	263	381	4.18e-25	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000106305
AA Change: N260K

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000101912
Gene: ENSMUSG00000017132
AA Change: N260K

Domain	Start	End	E-Value	Type
Sec7	59	244	1.38e-108	SMART
PH	261	379	4.18e-25	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000151165

SMART Domains

Protein: ENSMUSP00000114792
Gene: ENSMUSG00000017132

Domain	Start	End	E-Value	Type
SCOP:d1pbv__	55	99	4e-15	SMART
PDB:1BC9\|A	60	99	9e-21	PDB
Blast:Sec7	61	99	1e-20	BLAST

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the PSCD family. Members of this family have identical structural organization that consists of an N-terminal coiled-coil motif, a central Sec7 domain, and a C-terminal pleckstrin homology (PH) domain. The coiled-coil motif is involved in homodimerization, the Sec7 domain contains guanine-nucleotide exchange protein activity, and the PH domain interacts with phospholipids and is responsible for association of PSCDs with membranes. Members of this family appear to mediate the regulation of protein sorting and membrane trafficking. This gene is highly expressed in natural killer and peripheral T cells, and regulates the adhesiveness of integrins at the plasma membrane of lymphocytes. A pseudogene of this gene has been defined on the X chromosome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit normal brain morphology and long term potentiation. Mice homozygous for a knock-out allele exhibit decreased myelin sheath thickness due to hypomyelination. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610318N02Rik	A	T	16: 17,118,404	L152Q	probably benign	Het
Abcg3	A	T	5: 104,966,774	N292K	probably damaging	Het
Adamts3	T	A	5: 89,707,450		probably null	Het
Adgrg7	T	C	16: 56,742,418	N519D	probably benign	Het
Adsl	A	G	15: 80,962,782	H263R	probably damaging	Het
Ak9	A	T	10: 41,423,004	D1567V	unknown	Het
Bscl2	T	C	19: 8,846,550	F280L	possibly damaging	Het
Cacna1b	T	A	2: 24,679,294	T873S	probably benign	Het
Cacna1c	T	C	6: 119,052,708		probably null	Het
Cast	G	T	13: 74,808,458	A18E	unknown	Het
Ccdc114	A	C	7: 45,942,765	Q323P	probably damaging	Het
Cd207	A	C	6: 83,677,848		probably benign	Het
Cd79b	A	G	11: 106,312,852	S130P	probably benign	Het
Cfap52	A	T	11: 67,949,633	N157K	probably benign	Het
Cfap57	C	T	4: 118,614,931	V84I	probably benign	Het
Chaf1b	G	T	16: 93,884,380		probably benign	Het
Cntn1	A	G	15: 92,317,989	I968V	probably benign	Het
Cntn5	C	T	9: 9,833,461	V362I	probably benign	Het
Crem	A	G	18: 3,295,329	S80P	probably damaging	Het
Csnk1g3	C	T	18: 53,930,318	T267I	probably damaging	Het
Dicer1	C	T	12: 104,712,278	G594S	probably benign	Het
Enpp1	C	T	10: 24,645,282	C849Y	probably damaging	Het
Fam193a	A	G	5: 34,465,635	E1189G	possibly damaging	Het
Fermt1	C	A	2: 132,917,559	V426L	probably benign	Het
Fes	A	G	7: 80,378,776		probably null	Het
Gm16486	T	C	8: 70,717,272	I1337T	probably benign	Het
Gmeb1	C	A	4: 132,225,774	L560F	probably damaging	Het
Hace1	T	C	10: 45,670,626	L452P	probably damaging	Het
Hecw2	T	A	1: 53,904,343	H975L	probably damaging	Het
Idh2	GGTCCCAG	GG	7: 80,098,329		probably benign	Het
Il1r2	T	A	1: 40,123,210	C338S	probably damaging	Het
Kcnb1	T	C	2: 167,188,284	S114G	probably damaging	Het
Lce1c	A	T	3: 92,680,316	T17S	unknown	Het
Lhfpl4	C	A	6: 113,176,666	L141F	possibly damaging	Het
Ms4a14	T	C	19: 11,302,230	E988G	possibly damaging	Het
Naip5	T	C	13: 100,219,696	Q1137R	probably benign	Het
Naip5	G	T	13: 100,219,697	Q1137K	not run	Het
Neurod1	T	A	2: 79,454,946	D31V	probably benign	Het
Neurod4	A	G	10: 130,271,058	C116R	probably damaging	Het
Nisch	A	G	14: 31,206,580	V28A	probably benign	Het
Olfr1174-ps	T	G	2: 88,311,428	M123L	probably benign	Het
Olfr1245	A	G	2: 89,575,105	V207A	probably benign	Het
Pabpc4l	A	T	3: 46,446,252	I319N	probably damaging	Het
Pabpc4l	T	A	3: 46,446,589	R207W	probably damaging	Het
Pcm1	G	A	8: 41,309,531	D1371N	probably damaging	Het
Peg10	G	GGTC	6: 4,756,452		probably benign	Het
Plxnc1	C	T	10: 94,871,005	A557T	probably benign	Het
Prkdc	T	A	16: 15,648,738	V58D	probably damaging	Het
Prpf40a	A	G	2: 53,156,947	V259A	probably benign	Het
Psmd3	A	T	11: 98,685,640	T123S	probably benign	Het
Ptgr2	G	T	12: 84,292,329		probably benign	Het
Ptprr	A	G	10: 116,048,236	H66R	probably benign	Het
Rftn2	A	G	1: 55,194,242		probably null	Het
Rsph14	T	A	10: 75,029,796	E70V	possibly damaging	Het
Slc24a5	G	A	2: 125,088,191	V471I	probably benign	Het
Sorbs1	G	C	19: 40,376,800	R180G	probably benign	Het
Spag9	A	T	11: 94,097,689	T862S	probably benign	Het
Ssbp2	T	A	13: 91,690,883	D291E	probably benign	Het
Supt5	T	C	7: 28,323,772	K329E	probably damaging	Het
Syne2	G	T	12: 75,967,381	K3115N	probably damaging	Het
Tars	A	T	15: 11,392,009	L239*	probably null	Het
Tbxa2r	T	C	10: 81,332,791	Y105H	probably benign	Het
Tesk1	T	A	4: 43,445,743	D265E	probably damaging	Het
Tril	T	C	6: 53,818,281	D652G	possibly damaging	Het
Tsga10	T	C	1: 37,834,187	R204G	probably null	Het
Twnk	A	G	19: 45,011,780	D645G	probably benign	Het
Umodl1	A	T	17: 30,998,148	D1118V	probably damaging	Het
Unc119	T	C	11: 78,347,245	I83T	probably benign	Het
Unc80	T	C	1: 66,646,415	W2233R	possibly damaging	Het
Vmn1r45	T	A	6: 89,933,434	T185S	possibly damaging	Het
Vmn2r111	G	T	17: 22,571,086	T313K	possibly damaging	Het
Wdr4	A	G	17: 31,509,832	L123S	probably damaging	Het
Zfpm2	A	G	15: 41,102,990	E957G	possibly damaging	Het

Other mutations in Cyth1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01327:Cyth1	APN	11	118193613	critical splice donor site	probably null
IGL02047:Cyth1	APN	11	118169132	missense	probably damaging	1.00
IGL02658:Cyth1	APN	11	118182246	missense	probably damaging	0.99
IGL02826:Cyth1	APN	11	118185481	missense	possibly damaging	0.89
Mucilage	UTSW	11	118170860	missense	probably damaging	1.00
Stuck	UTSW	11	118185759	critical splice donor site	probably null
tarred	UTSW	11	118183923	nonsense	probably null
R0109:Cyth1	UTSW	11	118182306	missense	probably damaging	0.98
R0109:Cyth1	UTSW	11	118182306	missense	probably damaging	0.98
R0470:Cyth1	UTSW	11	118132248	unclassified	probably benign
R1387:Cyth1	UTSW	11	118182346	unclassified	probably benign
R1599:Cyth1	UTSW	11	118177221	missense	probably damaging	0.99
R2098:Cyth1	UTSW	11	118193653	missense	probably damaging	1.00
R2156:Cyth1	UTSW	11	118182808	missense	probably damaging	1.00
R3546:Cyth1	UTSW	11	118192436	missense	probably damaging	0.96
R4300:Cyth1	UTSW	11	118183894	missense	probably damaging	0.98
R4589:Cyth1	UTSW	11	118184985	missense	possibly damaging	0.70
R4799:Cyth1	UTSW	11	118183942	missense	probably damaging	1.00
R5165:Cyth1	UTSW	11	118169082	missense	possibly damaging	0.82
R5524:Cyth1	UTSW	11	118182767	missense	probably benign	0.27
R5834:Cyth1	UTSW	11	118192463	critical splice acceptor site	probably null
R5933:Cyth1	UTSW	11	118185759	critical splice donor site	probably null
R5960:Cyth1	UTSW	11	118132367	unclassified	probably benign
R6609:Cyth1	UTSW	11	118170860	missense	probably damaging	1.00
R7014:Cyth1	UTSW	11	118212651	missense	probably benign
R7108:Cyth1	UTSW	11	118182913	missense	probably damaging	0.99
R7237:Cyth1	UTSW	11	118185495	missense	probably damaging	1.00
R7424:Cyth1	UTSW	11	118184009	splice site	probably null
R7523:Cyth1	UTSW	11	118183923	nonsense	probably null
R7574:Cyth1	UTSW	11	118182863	missense	probably damaging	1.00
R7647:Cyth1	UTSW	11	118177288	missense	probably benign	0.00
R7731:Cyth1	UTSW	11	118169053	missense	possibly damaging	0.55
R7848:Cyth1	UTSW	11	118183923	nonsense	probably null
R7849:Cyth1	UTSW	11	118183923	nonsense	probably null
R8755:Cyth1	UTSW	11	118183942	missense	probably benign	0.31
R8781:Cyth1	UTSW	11	118182243	missense	probably damaging	0.98
R9045:Cyth1	UTSW	11	118182264	missense	possibly damaging	0.72
R9062:Cyth1	UTSW	11	118132316	missense	unknown
R9299:Cyth1	UTSW	11	118169011	splice site	probably benign
R9393:Cyth1	UTSW	11	118183884	missense	probably benign	0.28
R9476:Cyth1	UTSW	11	118185380	critical splice donor site	probably null
R9510:Cyth1	UTSW	11	118185380	critical splice donor site	probably null
X0063:Cyth1	UTSW	11	118132329	unclassified	probably benign

Predicted Primers

PCR Primer
(F):5'- AGAGTCTGTGTCCAGGAGTCTG -3'
(R):5'- AGCAGAGAATGGCCATGTTC -3'

Sequencing Primer
(F):5'- CCAGGAGTCTGTTCTGTGGTGAC -3'
(R):5'- AGCAGAGAATGGCCATGTTCTTTTC -3'

Posted On

2019-09-13