Incidental Mutation 'R7401:Cast'
ID 574190
Institutional Source Beutler Lab
Gene Symbol Cast
Ensembl Gene ENSMUSG00000021585
Gene Name calpastatin
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7401 (G1)
Quality Score 187.009
Status Not validated
Chromosome 13
Chromosomal Location 74692368-74808810 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 74808458 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Glutamic Acid at position 18 (A18E)
Ref Sequence ENSEMBL: ENSMUSP00000152174 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065629] [ENSMUST00000223206] [ENSMUST00000231578]
AlphaFold P51125
Predicted Effect probably benign
Transcript: ENSMUST00000065629
SMART Domains Protein: ENSMUSP00000065275
Gene: ENSMUSG00000021585

DomainStartEndE-ValueType
Pfam:Calpain_inhib 15 272 8.1e-9 PFAM
Pfam:Calpain_inhib 279 404 2.7e-36 PFAM
Pfam:Calpain_inhib 415 544 3.6e-38 PFAM
Pfam:Calpain_inhib 556 684 4.5e-36 PFAM
low complexity region 708 744 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000223206
AA Change: A18E
Predicted Effect unknown
Transcript: ENSMUST00000231578
AA Change: A18E
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes an inhibitor of the calcium-dependent cysteine protease, calpain. This protein plays roles in multiple processes, including apoptosis, cell cycle regulation, and membrane fusion. Multiple protein isoforms exist which contain unique N-terminal domains, and multiple inhibitory domains that share homology with each other. Some isoforms may be tissue-specific. Two different pseudogenes of this gene are found on chromosome 19. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a knockout allele exhibit augmented DNA fragmentation in CA1 pyramidal neurons following excitotoxic kainate treatment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610318N02Rik A T 16: 17,118,404 L152Q probably benign Het
Abcg3 A T 5: 104,966,774 N292K probably damaging Het
Adamts3 T A 5: 89,707,450 probably null Het
Adgrg7 T C 16: 56,742,418 N519D probably benign Het
Adsl A G 15: 80,962,782 H263R probably damaging Het
Ak9 A T 10: 41,423,004 D1567V unknown Het
Bscl2 T C 19: 8,846,550 F280L possibly damaging Het
Cacna1b T A 2: 24,679,294 T873S probably benign Het
Cacna1c T C 6: 119,052,708 probably null Het
Ccdc114 A C 7: 45,942,765 Q323P probably damaging Het
Cd207 A C 6: 83,677,848 probably benign Het
Cd79b A G 11: 106,312,852 S130P probably benign Het
Cfap52 A T 11: 67,949,633 N157K probably benign Het
Cfap57 C T 4: 118,614,931 V84I probably benign Het
Chaf1b G T 16: 93,884,380 probably benign Het
Cntn1 A G 15: 92,317,989 I968V probably benign Het
Cntn5 C T 9: 9,833,461 V362I probably benign Het
Crem A G 18: 3,295,329 S80P probably damaging Het
Csnk1g3 C T 18: 53,930,318 T267I probably damaging Het
Cyth1 A T 11: 118,182,251 N274K possibly damaging Het
Dicer1 C T 12: 104,712,278 G594S probably benign Het
Enpp1 C T 10: 24,645,282 C849Y probably damaging Het
Fam193a A G 5: 34,465,635 E1189G possibly damaging Het
Fermt1 C A 2: 132,917,559 V426L probably benign Het
Fes A G 7: 80,378,776 probably null Het
Gm16486 T C 8: 70,717,272 I1337T probably benign Het
Gmeb1 C A 4: 132,225,774 L560F probably damaging Het
Hace1 T C 10: 45,670,626 L452P probably damaging Het
Hecw2 T A 1: 53,904,343 H975L probably damaging Het
Idh2 GGTCCCAG GG 7: 80,098,329 probably benign Het
Il1r2 T A 1: 40,123,210 C338S probably damaging Het
Kcnb1 T C 2: 167,188,284 S114G probably damaging Het
Lce1c A T 3: 92,680,316 T17S unknown Het
Lhfpl4 C A 6: 113,176,666 L141F possibly damaging Het
Ms4a14 T C 19: 11,302,230 E988G possibly damaging Het
Naip5 T C 13: 100,219,696 Q1137R probably benign Het
Naip5 G T 13: 100,219,697 Q1137K not run Het
Neurod1 T A 2: 79,454,946 D31V probably benign Het
Neurod4 A G 10: 130,271,058 C116R probably damaging Het
Nisch A G 14: 31,206,580 V28A probably benign Het
Olfr1174-ps T G 2: 88,311,428 M123L probably benign Het
Olfr1245 A G 2: 89,575,105 V207A probably benign Het
Pabpc4l A T 3: 46,446,252 I319N probably damaging Het
Pabpc4l T A 3: 46,446,589 R207W probably damaging Het
Pcm1 G A 8: 41,309,531 D1371N probably damaging Het
Peg10 G GGTC 6: 4,756,452 probably benign Het
Plxnc1 C T 10: 94,871,005 A557T probably benign Het
Prkdc T A 16: 15,648,738 V58D probably damaging Het
Prpf40a A G 2: 53,156,947 V259A probably benign Het
Psmd3 A T 11: 98,685,640 T123S probably benign Het
Ptgr2 G T 12: 84,292,329 probably benign Het
Ptprr A G 10: 116,048,236 H66R probably benign Het
Rftn2 A G 1: 55,194,242 probably null Het
Rsph14 T A 10: 75,029,796 E70V possibly damaging Het
Slc24a5 G A 2: 125,088,191 V471I probably benign Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Spag9 A T 11: 94,097,689 T862S probably benign Het
Ssbp2 T A 13: 91,690,883 D291E probably benign Het
Supt5 T C 7: 28,323,772 K329E probably damaging Het
Syne2 G T 12: 75,967,381 K3115N probably damaging Het
Tars A T 15: 11,392,009 L239* probably null Het
Tbxa2r T C 10: 81,332,791 Y105H probably benign Het
Tesk1 T A 4: 43,445,743 D265E probably damaging Het
Tril T C 6: 53,818,281 D652G possibly damaging Het
Tsga10 T C 1: 37,834,187 R204G probably null Het
Twnk A G 19: 45,011,780 D645G probably benign Het
Umodl1 A T 17: 30,998,148 D1118V probably damaging Het
Unc119 T C 11: 78,347,245 I83T probably benign Het
Unc80 T C 1: 66,646,415 W2233R possibly damaging Het
Vmn1r45 T A 6: 89,933,434 T185S possibly damaging Het
Vmn2r111 G T 17: 22,571,086 T313K possibly damaging Het
Wdr4 A G 17: 31,509,832 L123S probably damaging Het
Zfpm2 A G 15: 41,102,990 E957G possibly damaging Het
Other mutations in Cast
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00834:Cast APN 13 74736974 missense probably damaging 1.00
IGL01363:Cast APN 13 74704192 missense possibly damaging 0.95
IGL01404:Cast APN 13 74738287 nonsense probably null
IGL01893:Cast APN 13 74727289 nonsense probably null
IGL02139:Cast APN 13 74728365 missense possibly damaging 0.80
IGL02444:Cast APN 13 74739853 missense probably damaging 1.00
IGL02927:Cast APN 13 74736994 missense probably damaging 1.00
IGL02941:Cast APN 13 74700687 missense probably damaging 1.00
IGL02799:Cast UTSW 13 74736752 missense probably damaging 1.00
R0583:Cast UTSW 13 74713678 missense probably damaging 0.99
R2031:Cast UTSW 13 74798652 splice site probably null
R2256:Cast UTSW 13 74739905 missense probably damaging 0.99
R2509:Cast UTSW 13 74737616 missense probably benign 0.19
R3923:Cast UTSW 13 74728413 missense probably damaging 1.00
R4116:Cast UTSW 13 74724837 missense probably damaging 1.00
R4649:Cast UTSW 13 74746014 missense probably benign 0.25
R4651:Cast UTSW 13 74746014 missense probably benign 0.25
R4652:Cast UTSW 13 74746014 missense probably benign 0.25
R4653:Cast UTSW 13 74746014 missense probably benign 0.25
R4714:Cast UTSW 13 74798715 missense probably damaging 1.00
R4751:Cast UTSW 13 74746047 missense probably damaging 1.00
R4758:Cast UTSW 13 74739880 missense possibly damaging 0.90
R4974:Cast UTSW 13 74807823 missense probably benign
R5040:Cast UTSW 13 74724813 missense probably damaging 1.00
R5397:Cast UTSW 13 74720937 missense possibly damaging 0.83
R5556:Cast UTSW 13 74695889 critical splice donor site probably null
R5863:Cast UTSW 13 74736756 missense probably damaging 1.00
R6030:Cast UTSW 13 74695937 missense possibly damaging 0.83
R6030:Cast UTSW 13 74695937 missense possibly damaging 0.83
R6349:Cast UTSW 13 74721195 missense probably damaging 1.00
R6817:Cast UTSW 13 74699158 missense possibly damaging 0.78
R6829:Cast UTSW 13 74728344 missense possibly damaging 0.50
R6848:Cast UTSW 13 74695933 missense possibly damaging 0.66
R7275:Cast UTSW 13 74727334 missense probably benign 0.00
R7408:Cast UTSW 13 74739841 missense probably damaging 0.99
R7602:Cast UTSW 13 74736965 missense probably benign 0.26
R8032:Cast UTSW 13 74735241 nonsense probably null
R8499:Cast UTSW 13 74798716 missense probably benign 0.07
R8544:Cast UTSW 13 74734058 missense possibly damaging 0.92
R8557:Cast UTSW 13 74704182 missense probably damaging 1.00
R8709:Cast UTSW 13 74744661 missense probably damaging 0.96
X0011:Cast UTSW 13 74725456 missense probably damaging 1.00
X0066:Cast UTSW 13 74736979 missense probably damaging 1.00
Z1177:Cast UTSW 13 74725463 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AATTCGGAGAGCCTTTAGCC -3'
(R):5'- AAGTTGGGCTCTCTGCAGTG -3'

Sequencing Primer
(F):5'- AGAGCCTTTAGCCACCTGC -3'
(R):5'- TCGGAAAAGCTGCCTCACTGAG -3'
Posted On 2019-09-13