Incidental Mutation 'R7401:Zfpm2'
ID 574196
Institutional Source Beutler Lab
Gene Symbol Zfpm2
Ensembl Gene ENSMUSG00000022306
Gene Name zinc finger protein, multitype 2
Synonyms FOG2, B330005D23Rik, FOG-2
MMRRC Submission 045483-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7401 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 40518438-40967988 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 40966386 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 957 (E957G)
Ref Sequence ENSEMBL: ENSMUSP00000051335 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053467] [ENSMUST00000230319]
AlphaFold Q8CCH7
Predicted Effect possibly damaging
Transcript: ENSMUST00000053467
AA Change: E957G

PolyPhen 2 Score 0.866 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000051335
Gene: ENSMUSG00000022306
AA Change: E957G

DomainStartEndE-ValueType
low complexity region 19 35 N/A INTRINSIC
ZnF_C2H2 250 270 4.27e1 SMART
ZnF_C2H2 296 320 1.25e-1 SMART
ZnF_C2H2 335 357 4.05e-1 SMART
ZnF_C2H2 363 385 6.23e-2 SMART
ZnF_C2H2 548 569 1.43e1 SMART
ZnF_C2H2 687 714 1.06e2 SMART
low complexity region 731 741 N/A INTRINSIC
ZnF_C2H2 854 874 5.4e1 SMART
ZnF_C2H2 1119 1145 4.99e1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000230319
AA Change: E825G

PolyPhen 2 Score 0.866 (Sensitivity: 0.83; Specificity: 0.93)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The zinc finger protein encoded by this gene is a widely expressed member of the FOG family of transcription factors. The family members modulate the activity of GATA family proteins, which are important regulators of hematopoiesis and cardiogenesis in mammals. It has been demonstrated that the protein can both activate and down-regulate expression of GATA-target genes, suggesting different modulation in different promoter contexts. A related mRNA suggests an alternatively spliced product but this information is not yet fully supported by the sequence. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit cardiac defects, including absence of coronary vasculature, resulting in lethality between E12.5 and E15.5. Conditional mutations reveal errors in ovary and testis development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610318N02Rik A T 16: 16,936,268 (GRCm39) L152Q probably benign Het
Abcg3 A T 5: 105,114,640 (GRCm39) N292K probably damaging Het
Adamts3 T A 5: 89,855,309 (GRCm39) probably null Het
Adgrg7 T C 16: 56,562,781 (GRCm39) N519D probably benign Het
Adsl A G 15: 80,846,983 (GRCm39) H263R probably damaging Het
Ak9 A T 10: 41,299,000 (GRCm39) D1567V unknown Het
Bscl2 T C 19: 8,823,914 (GRCm39) F280L possibly damaging Het
Cacna1b T A 2: 24,569,306 (GRCm39) T873S probably benign Het
Cacna1c T C 6: 119,029,669 (GRCm39) probably null Het
Cast G T 13: 74,956,577 (GRCm39) A18E unknown Het
Cd207 A C 6: 83,654,830 (GRCm39) probably benign Het
Cd79b A G 11: 106,203,678 (GRCm39) S130P probably benign Het
Cfap52 A T 11: 67,840,459 (GRCm39) N157K probably benign Het
Cfap57 C T 4: 118,472,128 (GRCm39) V84I probably benign Het
Chaf1b G T 16: 93,681,268 (GRCm39) probably benign Het
Cntn1 A G 15: 92,215,870 (GRCm39) I968V probably benign Het
Cntn5 C T 9: 9,833,466 (GRCm39) V362I probably benign Het
Crem A G 18: 3,295,329 (GRCm39) S80P probably damaging Het
Csnk1g3 C T 18: 54,063,390 (GRCm39) T267I probably damaging Het
Cyth1 A T 11: 118,073,077 (GRCm39) N274K possibly damaging Het
Dicer1 C T 12: 104,678,537 (GRCm39) G594S probably benign Het
Enpp1 C T 10: 24,521,180 (GRCm39) C849Y probably damaging Het
Fam193a A G 5: 34,622,979 (GRCm39) E1189G possibly damaging Het
Fermt1 C A 2: 132,759,479 (GRCm39) V426L probably benign Het
Fes A G 7: 80,028,524 (GRCm39) probably null Het
Gmeb1 C A 4: 131,953,085 (GRCm39) L560F probably damaging Het
Hace1 T C 10: 45,546,722 (GRCm39) L452P probably damaging Het
Hecw2 T A 1: 53,943,502 (GRCm39) H975L probably damaging Het
Idh2 GGTCCCAG GG 7: 79,748,077 (GRCm39) probably benign Het
Il1r2 T A 1: 40,162,370 (GRCm39) C338S probably damaging Het
Iqcn T C 8: 71,169,921 (GRCm39) I1337T probably benign Het
Kcnb1 T C 2: 167,030,204 (GRCm39) S114G probably damaging Het
Lce1c A T 3: 92,587,623 (GRCm39) T17S unknown Het
Lhfpl4 C A 6: 113,153,627 (GRCm39) L141F possibly damaging Het
Ms4a14 T C 19: 11,279,594 (GRCm39) E988G possibly damaging Het
Naip5 G T 13: 100,356,205 (GRCm39) Q1137K not run Het
Naip5 T C 13: 100,356,204 (GRCm39) Q1137R probably benign Het
Neurod1 T A 2: 79,285,290 (GRCm39) D31V probably benign Het
Neurod4 A G 10: 130,106,927 (GRCm39) C116R probably damaging Het
Nisch A G 14: 30,928,537 (GRCm39) V28A probably benign Het
Odad1 A C 7: 45,592,189 (GRCm39) Q323P probably damaging Het
Or4a72 A G 2: 89,405,449 (GRCm39) V207A probably benign Het
Or5d44 T G 2: 88,141,772 (GRCm39) M123L probably benign Het
Pabpc4l T A 3: 46,401,024 (GRCm39) R207W probably damaging Het
Pabpc4l A T 3: 46,400,687 (GRCm39) I319N probably damaging Het
Pcm1 G A 8: 41,762,568 (GRCm39) D1371N probably damaging Het
Peg10 G GGTC 6: 4,756,452 (GRCm39) probably benign Het
Plxnc1 C T 10: 94,706,867 (GRCm39) A557T probably benign Het
Prkdc T A 16: 15,466,602 (GRCm39) V58D probably damaging Het
Prpf40a A G 2: 53,046,959 (GRCm39) V259A probably benign Het
Psmd3 A T 11: 98,576,466 (GRCm39) T123S probably benign Het
Ptgr2 G T 12: 84,339,103 (GRCm39) probably benign Het
Ptprr A G 10: 115,884,141 (GRCm39) H66R probably benign Het
Rftn2 A G 1: 55,233,401 (GRCm39) probably null Het
Rsph14 T A 10: 74,865,628 (GRCm39) E70V possibly damaging Het
Slc24a5 G A 2: 124,930,111 (GRCm39) V471I probably benign Het
Sorbs1 G C 19: 40,365,244 (GRCm39) R180G probably benign Het
Spag9 A T 11: 93,988,515 (GRCm39) T862S probably benign Het
Ssbp2 T A 13: 91,839,002 (GRCm39) D291E probably benign Het
Supt5 T C 7: 28,023,197 (GRCm39) K329E probably damaging Het
Syne2 G T 12: 76,014,155 (GRCm39) K3115N probably damaging Het
Tars1 A T 15: 11,392,095 (GRCm39) L239* probably null Het
Tbxa2r T C 10: 81,168,625 (GRCm39) Y105H probably benign Het
Tesk1 T A 4: 43,445,743 (GRCm39) D265E probably damaging Het
Tril T C 6: 53,795,266 (GRCm39) D652G possibly damaging Het
Tsga10 T C 1: 37,873,268 (GRCm39) R204G probably null Het
Twnk A G 19: 45,000,219 (GRCm39) D645G probably benign Het
Umodl1 A T 17: 31,217,122 (GRCm39) D1118V probably damaging Het
Unc119 T C 11: 78,238,071 (GRCm39) I83T probably benign Het
Unc80 T C 1: 66,685,574 (GRCm39) W2233R possibly damaging Het
Vmn1r45 T A 6: 89,910,416 (GRCm39) T185S possibly damaging Het
Vmn2r111 G T 17: 22,790,067 (GRCm39) T313K possibly damaging Het
Wdr4 A G 17: 31,728,806 (GRCm39) L123S probably damaging Het
Other mutations in Zfpm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00473:Zfpm2 APN 15 40,962,683 (GRCm39) missense probably damaging 1.00
IGL00815:Zfpm2 APN 15 40,962,887 (GRCm39) missense probably benign 0.37
IGL00821:Zfpm2 APN 15 40,966,783 (GRCm39) missense probably damaging 1.00
IGL01622:Zfpm2 APN 15 40,965,320 (GRCm39) missense probably benign 0.07
IGL01623:Zfpm2 APN 15 40,965,320 (GRCm39) missense probably benign 0.07
IGL01807:Zfpm2 APN 15 40,616,452 (GRCm39) critical splice donor site probably null
IGL01872:Zfpm2 APN 15 40,965,783 (GRCm39) missense probably benign
IGL02087:Zfpm2 APN 15 40,966,517 (GRCm39) missense probably damaging 0.97
IGL02123:Zfpm2 APN 15 40,965,591 (GRCm39) missense probably damaging 1.00
IGL02355:Zfpm2 APN 15 40,962,890 (GRCm39) missense probably damaging 1.00
IGL02362:Zfpm2 APN 15 40,962,890 (GRCm39) missense probably damaging 1.00
IGL02579:Zfpm2 APN 15 40,962,868 (GRCm39) missense possibly damaging 0.91
IGL02752:Zfpm2 APN 15 40,965,415 (GRCm39) missense probably benign 0.23
IGL02792:Zfpm2 APN 15 40,966,409 (GRCm39) missense probably benign 0.00
IGL02861:Zfpm2 APN 15 40,966,662 (GRCm39) missense probably damaging 0.98
IGL03180:Zfpm2 APN 15 40,964,790 (GRCm39) missense probably damaging 1.00
IGL03344:Zfpm2 APN 15 40,966,170 (GRCm39) missense probably benign
R0305:Zfpm2 UTSW 15 40,637,431 (GRCm39) splice site probably benign
R0365:Zfpm2 UTSW 15 40,637,462 (GRCm39) missense possibly damaging 0.88
R1171:Zfpm2 UTSW 15 40,965,075 (GRCm39) missense probably damaging 1.00
R1456:Zfpm2 UTSW 15 40,965,877 (GRCm39) missense probably damaging 1.00
R1482:Zfpm2 UTSW 15 40,962,687 (GRCm39) missense probably damaging 1.00
R1580:Zfpm2 UTSW 15 40,966,605 (GRCm39) missense possibly damaging 0.84
R2119:Zfpm2 UTSW 15 40,966,419 (GRCm39) missense probably damaging 1.00
R2189:Zfpm2 UTSW 15 40,964,579 (GRCm39) missense possibly damaging 0.76
R2867:Zfpm2 UTSW 15 40,962,785 (GRCm39) missense probably benign 0.06
R2867:Zfpm2 UTSW 15 40,962,785 (GRCm39) missense probably benign 0.06
R2886:Zfpm2 UTSW 15 40,965,719 (GRCm39) missense probably benign 0.44
R3024:Zfpm2 UTSW 15 40,966,355 (GRCm39) missense probably benign 0.00
R4043:Zfpm2 UTSW 15 40,734,023 (GRCm39) missense possibly damaging 0.94
R4178:Zfpm2 UTSW 15 40,966,940 (GRCm39) missense probably damaging 1.00
R4465:Zfpm2 UTSW 15 40,959,557 (GRCm39) missense probably benign 0.00
R5263:Zfpm2 UTSW 15 40,962,791 (GRCm39) missense probably benign 0.45
R5266:Zfpm2 UTSW 15 40,962,865 (GRCm39) missense probably benign 0.01
R5352:Zfpm2 UTSW 15 40,733,938 (GRCm39) missense probably benign 0.01
R5584:Zfpm2 UTSW 15 40,965,933 (GRCm39) missense probably benign 0.45
R5661:Zfpm2 UTSW 15 40,959,467 (GRCm39) nonsense probably null
R6437:Zfpm2 UTSW 15 40,962,793 (GRCm39) missense probably benign
R6660:Zfpm2 UTSW 15 40,518,981 (GRCm39) critical splice donor site probably null
R6742:Zfpm2 UTSW 15 40,965,114 (GRCm39) missense probably benign
R6749:Zfpm2 UTSW 15 40,818,104 (GRCm39) missense possibly damaging 0.90
R7363:Zfpm2 UTSW 15 40,616,413 (GRCm39) missense probably damaging 1.00
R7657:Zfpm2 UTSW 15 40,966,671 (GRCm39) missense possibly damaging 0.78
R7690:Zfpm2 UTSW 15 40,818,162 (GRCm39) missense possibly damaging 0.45
R7698:Zfpm2 UTSW 15 40,959,487 (GRCm39) missense probably benign 0.03
R7893:Zfpm2 UTSW 15 40,966,008 (GRCm39) missense probably damaging 1.00
R8081:Zfpm2 UTSW 15 40,965,644 (GRCm39) missense probably damaging 1.00
R8223:Zfpm2 UTSW 15 40,616,355 (GRCm39) missense probably benign 0.34
R9028:Zfpm2 UTSW 15 40,966,758 (GRCm39) missense possibly damaging 0.87
R9065:Zfpm2 UTSW 15 40,962,712 (GRCm39) missense possibly damaging 0.95
R9234:Zfpm2 UTSW 15 40,966,470 (GRCm39) missense probably damaging 1.00
R9474:Zfpm2 UTSW 15 40,966,867 (GRCm39) missense probably damaging 1.00
R9694:Zfpm2 UTSW 15 40,965,710 (GRCm39) missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- AAAGTGTTTCCGAATCCAGAAAGTG -3'
(R):5'- TACGGCACACCCATTTGAGG -3'

Sequencing Primer
(F):5'- TTTCCGAATCCAGAAAGTGAACGG -3'
(R):5'- ACACCCATTTGAGGAGGCCTG -3'
Posted On 2019-09-13