Mutagenetix > Incidental Mutation

Incidental Mutation 'R7401:Cntn1'

574198

Institutional Source

Beutler Lab

Gene Symbol

Cntn1

Ensembl Gene

ENSMUSG00000055022

Gene Name

contactin 1

Synonyms

CNTN, F3cam

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7401 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

92051165-92341967 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 92317989 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 968 (I968V)

Ref Sequence

ENSEMBL: ENSMUSP00000000109 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000000109] [ENSMUST00000068378] [ENSMUST00000169825]

AlphaFold

P12960

Predicted Effect

probably benign
Transcript: ENSMUST00000000109
AA Change: I968V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000000109
Gene: ENSMUSG00000055022
AA Change: I968V

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
IGc2	56	121	4.07e-4	SMART
IG	143	232	1.25e-4	SMART
IGc2	254	317	1.24e-17	SMART
IGc2	343	398	4.22e-11	SMART
IGc2	427	491	2.52e-9	SMART
IG	511	603	3.51e-8	SMART
FN3	606	692	6.69e-12	SMART
FN3	709	795	1.17e-2	SMART
FN3	811	892	1.16e-6	SMART
FN3	907	987	2.46e-1	SMART
low complexity region	995	1018	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000068378
AA Change: I968V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000067842
Gene: ENSMUSG00000055022
AA Change: I968V

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
IGc2	56	121	4.07e-4	SMART
IG	143	232	1.25e-4	SMART
IGc2	254	317	1.24e-17	SMART
IGc2	343	398	4.22e-11	SMART
IGc2	427	491	2.52e-9	SMART
IG	511	603	3.51e-8	SMART
FN3	606	692	6.69e-12	SMART
FN3	709	795	1.17e-2	SMART
FN3	811	892	1.16e-6	SMART
FN3	907	987	2.46e-1	SMART
low complexity region	995	1018	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000169825
AA Change: I968V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000133063
Gene: ENSMUSG00000055022
AA Change: I968V

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
IGc2	56	121	4.07e-4	SMART
IG	143	232	1.25e-4	SMART
IGc2	254	317	1.24e-17	SMART
IGc2	343	398	4.22e-11	SMART
IGc2	427	491	2.52e-9	SMART
IG	511	603	3.51e-8	SMART
FN3	606	692	6.69e-12	SMART
FN3	709	795	1.17e-2	SMART
FN3	811	892	1.16e-6	SMART
FN3	907	987	2.46e-1	SMART
low complexity region	995	1018	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the immunoglobulin superfamily. It is a glycosylphosphatidylinositol (GPI)-anchored neuronal membrane protein that functions as a cell adhesion molecule. It may play a role in the formation of axon connections in the developing nervous system. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mutations of this gene result in growth retardation, progressive ataxia and death prior to weaning. A targeted null mutation, but not a spontaneous mutation, causes a small cerebellum with abnormalities of the molecular layer and abnormal Purkinje cellaxon morphology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610318N02Rik	A	T	16: 17,118,404	L152Q	probably benign	Het
Abcg3	A	T	5: 104,966,774	N292K	probably damaging	Het
Adamts3	T	A	5: 89,707,450		probably null	Het
Adgrg7	T	C	16: 56,742,418	N519D	probably benign	Het
Adsl	A	G	15: 80,962,782	H263R	probably damaging	Het
Ak9	A	T	10: 41,423,004	D1567V	unknown	Het
Bscl2	T	C	19: 8,846,550	F280L	possibly damaging	Het
Cacna1b	T	A	2: 24,679,294	T873S	probably benign	Het
Cacna1c	T	C	6: 119,052,708		probably null	Het
Cast	G	T	13: 74,808,458	A18E	unknown	Het
Ccdc114	A	C	7: 45,942,765	Q323P	probably damaging	Het
Cd207	A	C	6: 83,677,848		probably benign	Het
Cd79b	A	G	11: 106,312,852	S130P	probably benign	Het
Cfap52	A	T	11: 67,949,633	N157K	probably benign	Het
Cfap57	C	T	4: 118,614,931	V84I	probably benign	Het
Chaf1b	G	T	16: 93,884,380		probably benign	Het
Cntn5	C	T	9: 9,833,461	V362I	probably benign	Het
Crem	A	G	18: 3,295,329	S80P	probably damaging	Het
Csnk1g3	C	T	18: 53,930,318	T267I	probably damaging	Het
Cyth1	A	T	11: 118,182,251	N274K	possibly damaging	Het
Dicer1	C	T	12: 104,712,278	G594S	probably benign	Het
Enpp1	C	T	10: 24,645,282	C849Y	probably damaging	Het
Fam193a	A	G	5: 34,465,635	E1189G	possibly damaging	Het
Fermt1	C	A	2: 132,917,559	V426L	probably benign	Het
Fes	A	G	7: 80,378,776		probably null	Het
Gm16486	T	C	8: 70,717,272	I1337T	probably benign	Het
Gmeb1	C	A	4: 132,225,774	L560F	probably damaging	Het
Hace1	T	C	10: 45,670,626	L452P	probably damaging	Het
Hecw2	T	A	1: 53,904,343	H975L	probably damaging	Het
Idh2	GGTCCCAG	GG	7: 80,098,329		probably benign	Het
Il1r2	T	A	1: 40,123,210	C338S	probably damaging	Het
Kcnb1	T	C	2: 167,188,284	S114G	probably damaging	Het
Lce1c	A	T	3: 92,680,316	T17S	unknown	Het
Lhfpl4	C	A	6: 113,176,666	L141F	possibly damaging	Het
Ms4a14	T	C	19: 11,302,230	E988G	possibly damaging	Het
Naip5	T	C	13: 100,219,696	Q1137R	probably benign	Het
Naip5	G	T	13: 100,219,697	Q1137K	not run	Het
Neurod1	T	A	2: 79,454,946	D31V	probably benign	Het
Neurod4	A	G	10: 130,271,058	C116R	probably damaging	Het
Nisch	A	G	14: 31,206,580	V28A	probably benign	Het
Olfr1174-ps	T	G	2: 88,311,428	M123L	probably benign	Het
Olfr1245	A	G	2: 89,575,105	V207A	probably benign	Het
Pabpc4l	A	T	3: 46,446,252	I319N	probably damaging	Het
Pabpc4l	T	A	3: 46,446,589	R207W	probably damaging	Het
Pcm1	G	A	8: 41,309,531	D1371N	probably damaging	Het
Peg10	G	GGTC	6: 4,756,452		probably benign	Het
Plxnc1	C	T	10: 94,871,005	A557T	probably benign	Het
Prkdc	T	A	16: 15,648,738	V58D	probably damaging	Het
Prpf40a	A	G	2: 53,156,947	V259A	probably benign	Het
Psmd3	A	T	11: 98,685,640	T123S	probably benign	Het
Ptgr2	G	T	12: 84,292,329		probably benign	Het
Ptprr	A	G	10: 116,048,236	H66R	probably benign	Het
Rftn2	A	G	1: 55,194,242		probably null	Het
Rsph14	T	A	10: 75,029,796	E70V	possibly damaging	Het
Slc24a5	G	A	2: 125,088,191	V471I	probably benign	Het
Sorbs1	G	C	19: 40,376,800	R180G	probably benign	Het
Spag9	A	T	11: 94,097,689	T862S	probably benign	Het
Ssbp2	T	A	13: 91,690,883	D291E	probably benign	Het
Supt5	T	C	7: 28,323,772	K329E	probably damaging	Het
Syne2	G	T	12: 75,967,381	K3115N	probably damaging	Het
Tars	A	T	15: 11,392,009	L239*	probably null	Het
Tbxa2r	T	C	10: 81,332,791	Y105H	probably benign	Het
Tesk1	T	A	4: 43,445,743	D265E	probably damaging	Het
Tril	T	C	6: 53,818,281	D652G	possibly damaging	Het
Tsga10	T	C	1: 37,834,187	R204G	probably null	Het
Twnk	A	G	19: 45,011,780	D645G	probably benign	Het
Umodl1	A	T	17: 30,998,148	D1118V	probably damaging	Het
Unc119	T	C	11: 78,347,245	I83T	probably benign	Het
Unc80	T	C	1: 66,646,415	W2233R	possibly damaging	Het
Vmn1r45	T	A	6: 89,933,434	T185S	possibly damaging	Het
Vmn2r111	G	T	17: 22,571,086	T313K	possibly damaging	Het
Wdr4	A	G	17: 31,509,832	L123S	probably damaging	Het
Zfpm2	A	G	15: 41,102,990	E957G	possibly damaging	Het

Other mutations in Cntn1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00158:Cntn1	APN	15	92250877	missense	possibly damaging	0.92
IGL01109:Cntn1	APN	15	92339577	nonsense	probably null
IGL01399:Cntn1	APN	15	92305144	missense	probably damaging	1.00
IGL01714:Cntn1	APN	15	92253989	nonsense	probably null
IGL02052:Cntn1	APN	15	92291703	missense	possibly damaging	0.95
IGL02342:Cntn1	APN	15	92246017	missense	probably benign	0.01
IGL02507:Cntn1	APN	15	92250979	missense	possibly damaging	0.92
IGL02511:Cntn1	APN	15	92216385	start gained	probably benign
IGL02702:Cntn1	APN	15	92291601	splice site	probably benign
IGL02927:Cntn1	APN	15	92291680	missense	probably benign	0.12
IGL02948:Cntn1	APN	15	92246010	missense	probably benign	0.01
R0035:Cntn1	UTSW	15	92232088	splice site	probably benign
R0084:Cntn1	UTSW	15	92317917	missense	probably benign	0.01
R0346:Cntn1	UTSW	15	92232087	splice site	probably benign
R0634:Cntn1	UTSW	15	92314563	nonsense	probably null
R1348:Cntn1	UTSW	15	92314663	missense	probably damaging	1.00
R1613:Cntn1	UTSW	15	92245990	missense	possibly damaging	0.60
R1793:Cntn1	UTSW	15	92291671	missense	possibly damaging	0.92
R1815:Cntn1	UTSW	15	92250948	missense	probably benign	0.00
R1851:Cntn1	UTSW	15	92305140	missense	probably damaging	1.00
R1852:Cntn1	UTSW	15	92305140	missense	probably damaging	1.00
R2068:Cntn1	UTSW	15	92318062	missense	possibly damaging	0.82
R2269:Cntn1	UTSW	15	92294982	splice site	probably benign
R4394:Cntn1	UTSW	15	92291764	missense	probably damaging	1.00
R4667:Cntn1	UTSW	15	92295079	missense	probably damaging	1.00
R4771:Cntn1	UTSW	15	92305091	missense	possibly damaging	0.82
R4944:Cntn1	UTSW	15	92228668	missense	probably damaging	1.00
R5044:Cntn1	UTSW	15	92242995	missense	probably damaging	1.00
R5218:Cntn1	UTSW	15	92339549	missense	unknown
R5314:Cntn1	UTSW	15	92295011	missense	probably benign	0.01
R5445:Cntn1	UTSW	15	92295077	missense	probably damaging	1.00
R5518:Cntn1	UTSW	15	92314653	missense	probably benign	0.00
R6849:Cntn1	UTSW	15	92305246	missense	probably damaging	0.99
R6885:Cntn1	UTSW	15	92243099	critical splice donor site	probably null
R7035:Cntn1	UTSW	15	92314511	missense	probably benign	0.04
R7070:Cntn1	UTSW	15	92254036	missense	probably damaging	1.00
R7287:Cntn1	UTSW	15	92245952	splice site	probably null
R7311:Cntn1	UTSW	15	92232275	critical splice donor site	probably null
R7484:Cntn1	UTSW	15	92254041	missense	probably benign	0.00
R7492:Cntn1	UTSW	15	92314542	missense	probably benign
R7617:Cntn1	UTSW	15	92246089	missense	probably damaging	1.00
R7644:Cntn1	UTSW	15	92310009	missense	probably benign	0.14
R7878:Cntn1	UTSW	15	92295053	missense	probably damaging	1.00
R8354:Cntn1	UTSW	15	92232249	missense	probably benign
R8454:Cntn1	UTSW	15	92232249	missense	probably benign
R8465:Cntn1	UTSW	15	92339523	frame shift	probably null
R8757:Cntn1	UTSW	15	92255920	missense	possibly damaging	0.90
R8759:Cntn1	UTSW	15	92255920	missense	possibly damaging	0.90
R8767:Cntn1	UTSW	15	92234466	missense	probably damaging	1.00
R8768:Cntn1	UTSW	15	92234466	missense	probably damaging	1.00
R8885:Cntn1	UTSW	15	92261499	missense	probably benign	0.00
R8972:Cntn1	UTSW	15	92252397	missense	probably benign	0.18
R8993:Cntn1	UTSW	15	92234466	missense	probably damaging	1.00
R8995:Cntn1	UTSW	15	92234466	missense	probably damaging	1.00
R8997:Cntn1	UTSW	15	92234466	missense	probably damaging	1.00
R9151:Cntn1	UTSW	15	92242983	missense	probably damaging	1.00
R9438:Cntn1	UTSW	15	92246143	critical splice donor site	probably null
R9493:Cntn1	UTSW	15	92291763	missense	probably damaging	1.00
Z1177:Cntn1	UTSW	15	92309970	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTATAAGCTCCAGGTTAGCAGG -3'
(R):5'- AGACGCTGATGTTGTGAACG -3'

Sequencing Primer
(F):5'- TTCCTGAGGAATCAAGACATCAG -3'
(R):5'- ACGCCGGTTCTAAAGTTCAC -3'

Posted On

2019-09-13