Incidental Mutation 'R7401:Cntn1'
ID 574198
Institutional Source Beutler Lab
Gene Symbol Cntn1
Ensembl Gene ENSMUSG00000055022
Gene Name contactin 1
Synonyms F3cam, usl, CNTN
MMRRC Submission 045483-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7401 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 91949034-92239834 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 92215870 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 968 (I968V)
Ref Sequence ENSEMBL: ENSMUSP00000000109 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000109] [ENSMUST00000068378] [ENSMUST00000169825]
AlphaFold P12960
Predicted Effect probably benign
Transcript: ENSMUST00000000109
AA Change: I968V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000000109
Gene: ENSMUSG00000055022
AA Change: I968V

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IGc2 56 121 4.07e-4 SMART
IG 143 232 1.25e-4 SMART
IGc2 254 317 1.24e-17 SMART
IGc2 343 398 4.22e-11 SMART
IGc2 427 491 2.52e-9 SMART
IG 511 603 3.51e-8 SMART
FN3 606 692 6.69e-12 SMART
FN3 709 795 1.17e-2 SMART
FN3 811 892 1.16e-6 SMART
FN3 907 987 2.46e-1 SMART
low complexity region 995 1018 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000068378
AA Change: I968V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000067842
Gene: ENSMUSG00000055022
AA Change: I968V

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IGc2 56 121 4.07e-4 SMART
IG 143 232 1.25e-4 SMART
IGc2 254 317 1.24e-17 SMART
IGc2 343 398 4.22e-11 SMART
IGc2 427 491 2.52e-9 SMART
IG 511 603 3.51e-8 SMART
FN3 606 692 6.69e-12 SMART
FN3 709 795 1.17e-2 SMART
FN3 811 892 1.16e-6 SMART
FN3 907 987 2.46e-1 SMART
low complexity region 995 1018 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169825
AA Change: I968V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000133063
Gene: ENSMUSG00000055022
AA Change: I968V

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IGc2 56 121 4.07e-4 SMART
IG 143 232 1.25e-4 SMART
IGc2 254 317 1.24e-17 SMART
IGc2 343 398 4.22e-11 SMART
IGc2 427 491 2.52e-9 SMART
IG 511 603 3.51e-8 SMART
FN3 606 692 6.69e-12 SMART
FN3 709 795 1.17e-2 SMART
FN3 811 892 1.16e-6 SMART
FN3 907 987 2.46e-1 SMART
low complexity region 995 1018 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the immunoglobulin superfamily. It is a glycosylphosphatidylinositol (GPI)-anchored neuronal membrane protein that functions as a cell adhesion molecule. It may play a role in the formation of axon connections in the developing nervous system. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mutations of this gene result in growth retardation, progressive ataxia and death prior to weaning. A targeted null mutation, but not a spontaneous mutation, causes a small cerebellum with abnormalities of the molecular layer and abnormal Purkinje cellaxon morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610318N02Rik A T 16: 16,936,268 (GRCm39) L152Q probably benign Het
Abcg3 A T 5: 105,114,640 (GRCm39) N292K probably damaging Het
Adamts3 T A 5: 89,855,309 (GRCm39) probably null Het
Adgrg7 T C 16: 56,562,781 (GRCm39) N519D probably benign Het
Adsl A G 15: 80,846,983 (GRCm39) H263R probably damaging Het
Ak9 A T 10: 41,299,000 (GRCm39) D1567V unknown Het
Bscl2 T C 19: 8,823,914 (GRCm39) F280L possibly damaging Het
Cacna1b T A 2: 24,569,306 (GRCm39) T873S probably benign Het
Cacna1c T C 6: 119,029,669 (GRCm39) probably null Het
Cast G T 13: 74,956,577 (GRCm39) A18E unknown Het
Cd207 A C 6: 83,654,830 (GRCm39) probably benign Het
Cd79b A G 11: 106,203,678 (GRCm39) S130P probably benign Het
Cfap52 A T 11: 67,840,459 (GRCm39) N157K probably benign Het
Cfap57 C T 4: 118,472,128 (GRCm39) V84I probably benign Het
Chaf1b G T 16: 93,681,268 (GRCm39) probably benign Het
Cntn5 C T 9: 9,833,466 (GRCm39) V362I probably benign Het
Crem A G 18: 3,295,329 (GRCm39) S80P probably damaging Het
Csnk1g3 C T 18: 54,063,390 (GRCm39) T267I probably damaging Het
Cyth1 A T 11: 118,073,077 (GRCm39) N274K possibly damaging Het
Dicer1 C T 12: 104,678,537 (GRCm39) G594S probably benign Het
Enpp1 C T 10: 24,521,180 (GRCm39) C849Y probably damaging Het
Fam193a A G 5: 34,622,979 (GRCm39) E1189G possibly damaging Het
Fermt1 C A 2: 132,759,479 (GRCm39) V426L probably benign Het
Fes A G 7: 80,028,524 (GRCm39) probably null Het
Gmeb1 C A 4: 131,953,085 (GRCm39) L560F probably damaging Het
Hace1 T C 10: 45,546,722 (GRCm39) L452P probably damaging Het
Hecw2 T A 1: 53,943,502 (GRCm39) H975L probably damaging Het
Idh2 GGTCCCAG GG 7: 79,748,077 (GRCm39) probably benign Het
Il1r2 T A 1: 40,162,370 (GRCm39) C338S probably damaging Het
Iqcn T C 8: 71,169,921 (GRCm39) I1337T probably benign Het
Kcnb1 T C 2: 167,030,204 (GRCm39) S114G probably damaging Het
Lce1c A T 3: 92,587,623 (GRCm39) T17S unknown Het
Lhfpl4 C A 6: 113,153,627 (GRCm39) L141F possibly damaging Het
Ms4a14 T C 19: 11,279,594 (GRCm39) E988G possibly damaging Het
Naip5 T C 13: 100,356,204 (GRCm39) Q1137R probably benign Het
Naip5 G T 13: 100,356,205 (GRCm39) Q1137K not run Het
Neurod1 T A 2: 79,285,290 (GRCm39) D31V probably benign Het
Neurod4 A G 10: 130,106,927 (GRCm39) C116R probably damaging Het
Nisch A G 14: 30,928,537 (GRCm39) V28A probably benign Het
Odad1 A C 7: 45,592,189 (GRCm39) Q323P probably damaging Het
Or4a72 A G 2: 89,405,449 (GRCm39) V207A probably benign Het
Or5d44 T G 2: 88,141,772 (GRCm39) M123L probably benign Het
Pabpc4l T A 3: 46,401,024 (GRCm39) R207W probably damaging Het
Pabpc4l A T 3: 46,400,687 (GRCm39) I319N probably damaging Het
Pcm1 G A 8: 41,762,568 (GRCm39) D1371N probably damaging Het
Peg10 G GGTC 6: 4,756,452 (GRCm39) probably benign Het
Plxnc1 C T 10: 94,706,867 (GRCm39) A557T probably benign Het
Prkdc T A 16: 15,466,602 (GRCm39) V58D probably damaging Het
Prpf40a A G 2: 53,046,959 (GRCm39) V259A probably benign Het
Psmd3 A T 11: 98,576,466 (GRCm39) T123S probably benign Het
Ptgr2 G T 12: 84,339,103 (GRCm39) probably benign Het
Ptprr A G 10: 115,884,141 (GRCm39) H66R probably benign Het
Rftn2 A G 1: 55,233,401 (GRCm39) probably null Het
Rsph14 T A 10: 74,865,628 (GRCm39) E70V possibly damaging Het
Slc24a5 G A 2: 124,930,111 (GRCm39) V471I probably benign Het
Sorbs1 G C 19: 40,365,244 (GRCm39) R180G probably benign Het
Spag9 A T 11: 93,988,515 (GRCm39) T862S probably benign Het
Ssbp2 T A 13: 91,839,002 (GRCm39) D291E probably benign Het
Supt5 T C 7: 28,023,197 (GRCm39) K329E probably damaging Het
Syne2 G T 12: 76,014,155 (GRCm39) K3115N probably damaging Het
Tars1 A T 15: 11,392,095 (GRCm39) L239* probably null Het
Tbxa2r T C 10: 81,168,625 (GRCm39) Y105H probably benign Het
Tesk1 T A 4: 43,445,743 (GRCm39) D265E probably damaging Het
Tril T C 6: 53,795,266 (GRCm39) D652G possibly damaging Het
Tsga10 T C 1: 37,873,268 (GRCm39) R204G probably null Het
Twnk A G 19: 45,000,219 (GRCm39) D645G probably benign Het
Umodl1 A T 17: 31,217,122 (GRCm39) D1118V probably damaging Het
Unc119 T C 11: 78,238,071 (GRCm39) I83T probably benign Het
Unc80 T C 1: 66,685,574 (GRCm39) W2233R possibly damaging Het
Vmn1r45 T A 6: 89,910,416 (GRCm39) T185S possibly damaging Het
Vmn2r111 G T 17: 22,790,067 (GRCm39) T313K possibly damaging Het
Wdr4 A G 17: 31,728,806 (GRCm39) L123S probably damaging Het
Zfpm2 A G 15: 40,966,386 (GRCm39) E957G possibly damaging Het
Other mutations in Cntn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Cntn1 APN 15 92,148,758 (GRCm39) missense possibly damaging 0.92
IGL01109:Cntn1 APN 15 92,237,458 (GRCm39) nonsense probably null
IGL01399:Cntn1 APN 15 92,203,025 (GRCm39) missense probably damaging 1.00
IGL01714:Cntn1 APN 15 92,151,870 (GRCm39) nonsense probably null
IGL02052:Cntn1 APN 15 92,189,584 (GRCm39) missense possibly damaging 0.95
IGL02342:Cntn1 APN 15 92,143,898 (GRCm39) missense probably benign 0.01
IGL02507:Cntn1 APN 15 92,148,860 (GRCm39) missense possibly damaging 0.92
IGL02511:Cntn1 APN 15 92,114,266 (GRCm39) start gained probably benign
IGL02702:Cntn1 APN 15 92,189,482 (GRCm39) splice site probably benign
IGL02927:Cntn1 APN 15 92,189,561 (GRCm39) missense probably benign 0.12
IGL02948:Cntn1 APN 15 92,143,891 (GRCm39) missense probably benign 0.01
R0035:Cntn1 UTSW 15 92,129,969 (GRCm39) splice site probably benign
R0084:Cntn1 UTSW 15 92,215,798 (GRCm39) missense probably benign 0.01
R0346:Cntn1 UTSW 15 92,129,968 (GRCm39) splice site probably benign
R0634:Cntn1 UTSW 15 92,212,444 (GRCm39) nonsense probably null
R1348:Cntn1 UTSW 15 92,212,544 (GRCm39) missense probably damaging 1.00
R1613:Cntn1 UTSW 15 92,143,871 (GRCm39) missense possibly damaging 0.60
R1793:Cntn1 UTSW 15 92,189,552 (GRCm39) missense possibly damaging 0.92
R1815:Cntn1 UTSW 15 92,148,829 (GRCm39) missense probably benign 0.00
R1851:Cntn1 UTSW 15 92,203,021 (GRCm39) missense probably damaging 1.00
R1852:Cntn1 UTSW 15 92,203,021 (GRCm39) missense probably damaging 1.00
R2068:Cntn1 UTSW 15 92,215,943 (GRCm39) missense possibly damaging 0.82
R2269:Cntn1 UTSW 15 92,192,863 (GRCm39) splice site probably benign
R4394:Cntn1 UTSW 15 92,189,645 (GRCm39) missense probably damaging 1.00
R4667:Cntn1 UTSW 15 92,192,960 (GRCm39) missense probably damaging 1.00
R4771:Cntn1 UTSW 15 92,202,972 (GRCm39) missense possibly damaging 0.82
R4944:Cntn1 UTSW 15 92,126,549 (GRCm39) missense probably damaging 1.00
R5044:Cntn1 UTSW 15 92,140,876 (GRCm39) missense probably damaging 1.00
R5218:Cntn1 UTSW 15 92,237,430 (GRCm39) missense unknown
R5314:Cntn1 UTSW 15 92,192,892 (GRCm39) missense probably benign 0.01
R5445:Cntn1 UTSW 15 92,192,958 (GRCm39) missense probably damaging 1.00
R5518:Cntn1 UTSW 15 92,212,534 (GRCm39) missense probably benign 0.00
R6849:Cntn1 UTSW 15 92,203,127 (GRCm39) missense probably damaging 0.99
R6885:Cntn1 UTSW 15 92,140,980 (GRCm39) critical splice donor site probably null
R7035:Cntn1 UTSW 15 92,212,392 (GRCm39) missense probably benign 0.04
R7070:Cntn1 UTSW 15 92,151,917 (GRCm39) missense probably damaging 1.00
R7287:Cntn1 UTSW 15 92,143,833 (GRCm39) splice site probably null
R7311:Cntn1 UTSW 15 92,130,156 (GRCm39) critical splice donor site probably null
R7484:Cntn1 UTSW 15 92,151,922 (GRCm39) missense probably benign 0.00
R7492:Cntn1 UTSW 15 92,212,423 (GRCm39) missense probably benign
R7617:Cntn1 UTSW 15 92,143,970 (GRCm39) missense probably damaging 1.00
R7644:Cntn1 UTSW 15 92,207,890 (GRCm39) missense probably benign 0.14
R7878:Cntn1 UTSW 15 92,192,934 (GRCm39) missense probably damaging 1.00
R8354:Cntn1 UTSW 15 92,130,130 (GRCm39) missense probably benign
R8454:Cntn1 UTSW 15 92,130,130 (GRCm39) missense probably benign
R8465:Cntn1 UTSW 15 92,237,404 (GRCm39) frame shift probably null
R8757:Cntn1 UTSW 15 92,153,801 (GRCm39) missense possibly damaging 0.90
R8759:Cntn1 UTSW 15 92,153,801 (GRCm39) missense possibly damaging 0.90
R8767:Cntn1 UTSW 15 92,132,347 (GRCm39) missense probably damaging 1.00
R8768:Cntn1 UTSW 15 92,132,347 (GRCm39) missense probably damaging 1.00
R8885:Cntn1 UTSW 15 92,159,380 (GRCm39) missense probably benign 0.00
R8972:Cntn1 UTSW 15 92,150,278 (GRCm39) missense probably benign 0.18
R8993:Cntn1 UTSW 15 92,132,347 (GRCm39) missense probably damaging 1.00
R8995:Cntn1 UTSW 15 92,132,347 (GRCm39) missense probably damaging 1.00
R8997:Cntn1 UTSW 15 92,132,347 (GRCm39) missense probably damaging 1.00
R9151:Cntn1 UTSW 15 92,140,864 (GRCm39) missense probably damaging 1.00
R9438:Cntn1 UTSW 15 92,144,024 (GRCm39) critical splice donor site probably null
R9493:Cntn1 UTSW 15 92,189,644 (GRCm39) missense probably damaging 1.00
Z1177:Cntn1 UTSW 15 92,207,851 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTATAAGCTCCAGGTTAGCAGG -3'
(R):5'- AGACGCTGATGTTGTGAACG -3'

Sequencing Primer
(F):5'- TTCCTGAGGAATCAAGACATCAG -3'
(R):5'- ACGCCGGTTCTAAAGTTCAC -3'
Posted On 2019-09-13