Mutagenetix > Incidental Mutations

Incidental Mutation 'R0625:Olfr477'

57420

Institutional Source

Beutler Lab

Gene Symbol

Olfr477

Ensembl Gene

ENSMUSG00000096151

Gene Name

olfactory receptor 477

Synonyms

GA_x6K02T2PBJ9-10319672-10320604, MOR204-1

MMRRC Submission

038814-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.168) question?

Stock #

R0625 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

107986693-107992723 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 107991189 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 275 (S275P)

Ref Sequence

ENSEMBL: ENSMUSP00000091654 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000091605] [ENSMUST00000214677]

Predicted Effect

probably damaging
Transcript: ENSMUST00000091605
AA Change: S275P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000091654
Gene: ENSMUSG00000096151
AA Change: S275P

Domain	Start	End	E-Value	Type
Pfam:7tm_4	31	308	8e-52	PFAM
Pfam:7tm_1	41	290	1.9e-18	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000214677
AA Change: S275P

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.5%
20x: 95.2%

Validation Efficiency

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930550C14Rik	T	C	9: 53,408,065	S2P	probably benign	Het
Abca16	A	C	7: 120,435,893	T301P	probably damaging	Het
Acer2	A	G	4: 86,887,162	D121G	possibly damaging	Het
Adgrd1	T	C	5: 129,171,931		probably null	Het
Arhgap11a	T	C	2: 113,841,711	I249V	probably benign	Het
Arhgap22	A	G	14: 33,366,714	E219G	probably benign	Het
C2cd4b	T	A	9: 67,759,751	S10T	probably benign	Het
Cnot6	A	T	11: 49,683,171	I224N	probably damaging	Het
Ctrc	T	C	4: 141,841,518	T125A	probably damaging	Het
Cxxc5	T	G	18: 35,858,589	S14R	unknown	Het
Cyp4f37	T	G	17: 32,634,678	F445L	probably damaging	Het
Dcbld1	T	G	10: 52,312,850	I186S	probably benign	Het
Dmxl2	T	C	9: 54,382,702	T2510A	probably benign	Het
Dnah3	A	G	7: 120,071,887	I591T	possibly damaging	Het
Dock5	A	T	14: 67,841,163	I204N	probably benign	Het
Dysf	G	A	6: 84,111,987		probably null	Het
Erich5	A	G	15: 34,471,369	E248G	probably damaging	Het
Fam160a1	A	G	3: 85,730,500	V164A	possibly damaging	Het
Foxm1	A	G	6: 128,373,871	S712G	probably damaging	Het
Frmpd1	A	G	4: 45,284,055	T959A	probably benign	Het
Gfra4	C	T	2: 131,040,256	V277I	probably null	Het
Hacd4	T	C	4: 88,435,010	I82V	probably benign	Het
Itih2	C	T	2: 10,123,414	V159I	possibly damaging	Het
Itpr2	T	A	6: 146,166,651	M2410L	probably benign	Het
March11	A	G	15: 26,311,043	I202V	probably damaging	Het
March3	A	G	18: 56,811,830		probably null	Het
Med12l	G	A	3: 59,247,437	E1135K	probably damaging	Het
Mib2	C	T	4: 155,659,460	G42S	probably damaging	Het
Mlx	T	C	11: 101,087,782	L78P	possibly damaging	Het
Muc5b	T	C	7: 141,846,427	C473R	unknown	Het
N4bp2l1	T	A	5: 150,576,745	R66*	probably null	Het
Nes	A	G	3: 87,977,172	T913A	possibly damaging	Het
Oas1a	T	C	5: 120,899,259	E235G	probably damaging	Het
Olfr1104	T	A	2: 87,021,620	H308L	probably benign	Het
Olfr905	T	C	9: 38,473,208	S154P	possibly damaging	Het
Parn	C	T	16: 13,640,294	V286I	probably benign	Het
Paxip1	G	A	5: 27,765,942	Q470*	probably null	Het
Phc2	C	G	4: 128,723,710	H510D	possibly damaging	Het
Pla2g4f	T	A	2: 120,305,041	D384V	probably damaging	Het
Plpbp	A	T	8: 27,045,131	N68I	probably damaging	Het
Podxl2	G	A	6: 88,849,955	A123V	possibly damaging	Het
Pole	A	T	5: 110,325,550	T1737S	possibly damaging	Het
Ppp3cc	T	C	14: 70,225,027	E396G	probably damaging	Het
Pramel7	T	A	2: 87,491,008	I228F	probably benign	Het
Prl7d1	A	T	13: 27,710,140	C149S	probably benign	Het
Qtrt1	G	T	9: 21,418,288	M217I	probably benign	Het
Sec24a	T	A	11: 51,729,454	D456V	probably damaging	Het
Shox2	T	G	3: 66,981,544		probably null	Het
Skint2	T	A	4: 112,624,086	S49T	probably damaging	Het
Smarca5	A	G	8: 80,720,686		probably null	Het
Sorcs2	T	A	5: 36,024,572	D1068V	possibly damaging	Het
Tmem114	T	C	16: 8,412,102		probably null	Het
Ttc7b	T	A	12: 100,355,046	M24L	probably benign	Het
Ttll3	A	G	6: 113,408,903		probably null	Het
Usp7	C	T	16: 8,704,982	D102N	probably benign	Het

Other mutations in Olfr477

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00907:Olfr477	APN	7	107990890	missense	probably damaging	0.97
IGL01078:Olfr477	APN	7	107990943	missense	probably benign	0.02
IGL01141:Olfr477	APN	7	107990551	missense	probably damaging	1.00
IGL02613:Olfr477	APN	7	107991174	nonsense	probably null
R0791:Olfr477	UTSW	7	107990533	missense	probably benign	0.27
R1254:Olfr477	UTSW	7	107990440	missense	probably benign	0.01
R1456:Olfr477	UTSW	7	107990398	missense	probably benign	0.06
R1522:Olfr477	UTSW	7	107990533	missense	probably benign	0.27
R1541:Olfr477	UTSW	7	107990841	missense	probably benign	0.10
R2889:Olfr477	UTSW	7	107990577	missense	probably benign	0.06
R5653:Olfr477	UTSW	7	107990385	missense	probably benign	0.38
R6146:Olfr477	UTSW	7	107990413	missense	probably damaging	1.00
R6190:Olfr477	UTSW	7	107991100	missense	probably damaging	1.00
R7103:Olfr477	UTSW	7	107990598	missense	possibly damaging	0.92
R7191:Olfr477	UTSW	7	107990646	missense	possibly damaging	0.88
R7553:Olfr477	UTSW	7	107990475	missense	probably benign	0.03
R7681:Olfr477	UTSW	7	107991148	missense	possibly damaging	0.80
Z1088:Olfr477	UTSW	7	107990731	missense	probably benign	0.42
Z1177:Olfr477	UTSW	7	107991094	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGACATACAGTAACACTCTCTGTGGC -3'
(R):5'- ACAAACAGTTGAGCAGCACTTACTAGG -3'

Sequencing Primer
(F):5'- CCTTCTGTGGACCAAATCAGATAG -3'
(R):5'- TGAGCAGCACTTACTAGGTACTAAC -3'

Posted On

2013-07-11