Incidental Mutation 'R7401:Chaf1b'
ID 574202
Institutional Source Beutler Lab
Gene Symbol Chaf1b
Ensembl Gene ENSMUSG00000022945
Gene Name chromatin assembly factor 1, subunit B
Synonyms MPHOSPH7, CAF1, CAF1A, CAF1P60, CAF-IP60, CAF-1 subunit B, CAF-I 60 kDa subunit, 2600017H24Rik
MMRRC Submission 045483-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.960) question?
Stock # R7401 (G1)
Quality Score 179.009
Status Not validated
Chromosome 16
Chromosomal Location 93680801-93703003 bp(+) (GRCm39)
Type of Mutation start gained
DNA Base Change (assembly) G to T at 93681268 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000121034 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023666] [ENSMUST00000117099] [ENSMUST00000120586] [ENSMUST00000142316]
AlphaFold Q9D0N7
Predicted Effect probably benign
Transcript: ENSMUST00000023666
SMART Domains Protein: ENSMUSP00000023666
Gene: ENSMUSG00000022945

DomainStartEndE-ValueType
WD40 3 45 4.95e0 SMART
WD40 55 94 4.44e-6 SMART
WD40 118 157 3.78e-9 SMART
WD40 160 199 5.86e-6 SMART
Blast:WD40 219 258 5e-10 BLAST
WD40 274 338 2.84e2 SMART
WD40 344 381 5.13e0 SMART
Pfam:CAF-1_p60_C 388 564 2e-75 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117099
SMART Domains Protein: ENSMUSP00000113684
Gene: ENSMUSG00000022945

DomainStartEndE-ValueType
WD40 3 45 4.95e0 SMART
WD40 55 94 4.44e-6 SMART
WD40 118 157 3.78e-9 SMART
WD40 160 199 5.86e-6 SMART
Blast:WD40 219 258 5e-10 BLAST
WD40 274 338 2.84e2 SMART
WD40 344 381 5.13e0 SMART
Pfam:CAF-1_p60_C 388 561 6.3e-69 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120586
SMART Domains Protein: ENSMUSP00000113420
Gene: ENSMUSG00000022945

DomainStartEndE-ValueType
WD40 3 45 4.95e0 SMART
WD40 55 94 4.44e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000142316
SMART Domains Protein: ENSMUSP00000121034
Gene: ENSMUSG00000022945

DomainStartEndE-ValueType
Pfam:WD40 8 45 3.5e-4 PFAM
Blast:WD40 55 79 2e-9 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Chromatin assembly factor I (CAF-I) is required for the assembly of histone octamers onto newly-replicated DNA. CAF-I is composed of three protein subunits, p50, p60, and p150. The protein encoded by this gene corresponds to the p60 subunit and is required for chromatin assembly after replication. The encoded protein is differentially phosphorylated in a cell cycle-dependent manner. In addition, it is normally found in the nucleus except during mitosis, when it is released into the cytoplasm. This protein is a member of the WD-repeat HIR1 family and may also be involved in DNA repair. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610318N02Rik A T 16: 16,936,268 (GRCm39) L152Q probably benign Het
Abcg3 A T 5: 105,114,640 (GRCm39) N292K probably damaging Het
Adamts3 T A 5: 89,855,309 (GRCm39) probably null Het
Adgrg7 T C 16: 56,562,781 (GRCm39) N519D probably benign Het
Adsl A G 15: 80,846,983 (GRCm39) H263R probably damaging Het
Ak9 A T 10: 41,299,000 (GRCm39) D1567V unknown Het
Bscl2 T C 19: 8,823,914 (GRCm39) F280L possibly damaging Het
Cacna1b T A 2: 24,569,306 (GRCm39) T873S probably benign Het
Cacna1c T C 6: 119,029,669 (GRCm39) probably null Het
Cast G T 13: 74,956,577 (GRCm39) A18E unknown Het
Cd207 A C 6: 83,654,830 (GRCm39) probably benign Het
Cd79b A G 11: 106,203,678 (GRCm39) S130P probably benign Het
Cfap52 A T 11: 67,840,459 (GRCm39) N157K probably benign Het
Cfap57 C T 4: 118,472,128 (GRCm39) V84I probably benign Het
Cntn1 A G 15: 92,215,870 (GRCm39) I968V probably benign Het
Cntn5 C T 9: 9,833,466 (GRCm39) V362I probably benign Het
Crem A G 18: 3,295,329 (GRCm39) S80P probably damaging Het
Csnk1g3 C T 18: 54,063,390 (GRCm39) T267I probably damaging Het
Cyth1 A T 11: 118,073,077 (GRCm39) N274K possibly damaging Het
Dicer1 C T 12: 104,678,537 (GRCm39) G594S probably benign Het
Enpp1 C T 10: 24,521,180 (GRCm39) C849Y probably damaging Het
Fam193a A G 5: 34,622,979 (GRCm39) E1189G possibly damaging Het
Fermt1 C A 2: 132,759,479 (GRCm39) V426L probably benign Het
Fes A G 7: 80,028,524 (GRCm39) probably null Het
Gmeb1 C A 4: 131,953,085 (GRCm39) L560F probably damaging Het
Hace1 T C 10: 45,546,722 (GRCm39) L452P probably damaging Het
Hecw2 T A 1: 53,943,502 (GRCm39) H975L probably damaging Het
Idh2 GGTCCCAG GG 7: 79,748,077 (GRCm39) probably benign Het
Il1r2 T A 1: 40,162,370 (GRCm39) C338S probably damaging Het
Iqcn T C 8: 71,169,921 (GRCm39) I1337T probably benign Het
Kcnb1 T C 2: 167,030,204 (GRCm39) S114G probably damaging Het
Lce1c A T 3: 92,587,623 (GRCm39) T17S unknown Het
Lhfpl4 C A 6: 113,153,627 (GRCm39) L141F possibly damaging Het
Ms4a14 T C 19: 11,279,594 (GRCm39) E988G possibly damaging Het
Naip5 T C 13: 100,356,204 (GRCm39) Q1137R probably benign Het
Naip5 G T 13: 100,356,205 (GRCm39) Q1137K not run Het
Neurod1 T A 2: 79,285,290 (GRCm39) D31V probably benign Het
Neurod4 A G 10: 130,106,927 (GRCm39) C116R probably damaging Het
Nisch A G 14: 30,928,537 (GRCm39) V28A probably benign Het
Odad1 A C 7: 45,592,189 (GRCm39) Q323P probably damaging Het
Or4a72 A G 2: 89,405,449 (GRCm39) V207A probably benign Het
Or5d44 T G 2: 88,141,772 (GRCm39) M123L probably benign Het
Pabpc4l T A 3: 46,401,024 (GRCm39) R207W probably damaging Het
Pabpc4l A T 3: 46,400,687 (GRCm39) I319N probably damaging Het
Pcm1 G A 8: 41,762,568 (GRCm39) D1371N probably damaging Het
Peg10 G GGTC 6: 4,756,452 (GRCm39) probably benign Het
Plxnc1 C T 10: 94,706,867 (GRCm39) A557T probably benign Het
Prkdc T A 16: 15,466,602 (GRCm39) V58D probably damaging Het
Prpf40a A G 2: 53,046,959 (GRCm39) V259A probably benign Het
Psmd3 A T 11: 98,576,466 (GRCm39) T123S probably benign Het
Ptgr2 G T 12: 84,339,103 (GRCm39) probably benign Het
Ptprr A G 10: 115,884,141 (GRCm39) H66R probably benign Het
Rftn2 A G 1: 55,233,401 (GRCm39) probably null Het
Rsph14 T A 10: 74,865,628 (GRCm39) E70V possibly damaging Het
Slc24a5 G A 2: 124,930,111 (GRCm39) V471I probably benign Het
Sorbs1 G C 19: 40,365,244 (GRCm39) R180G probably benign Het
Spag9 A T 11: 93,988,515 (GRCm39) T862S probably benign Het
Ssbp2 T A 13: 91,839,002 (GRCm39) D291E probably benign Het
Supt5 T C 7: 28,023,197 (GRCm39) K329E probably damaging Het
Syne2 G T 12: 76,014,155 (GRCm39) K3115N probably damaging Het
Tars1 A T 15: 11,392,095 (GRCm39) L239* probably null Het
Tbxa2r T C 10: 81,168,625 (GRCm39) Y105H probably benign Het
Tesk1 T A 4: 43,445,743 (GRCm39) D265E probably damaging Het
Tril T C 6: 53,795,266 (GRCm39) D652G possibly damaging Het
Tsga10 T C 1: 37,873,268 (GRCm39) R204G probably null Het
Twnk A G 19: 45,000,219 (GRCm39) D645G probably benign Het
Umodl1 A T 17: 31,217,122 (GRCm39) D1118V probably damaging Het
Unc119 T C 11: 78,238,071 (GRCm39) I83T probably benign Het
Unc80 T C 1: 66,685,574 (GRCm39) W2233R possibly damaging Het
Vmn1r45 T A 6: 89,910,416 (GRCm39) T185S possibly damaging Het
Vmn2r111 G T 17: 22,790,067 (GRCm39) T313K possibly damaging Het
Wdr4 A G 17: 31,728,806 (GRCm39) L123S probably damaging Het
Zfpm2 A G 15: 40,966,386 (GRCm39) E957G possibly damaging Het
Other mutations in Chaf1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00562:Chaf1b APN 16 93,697,079 (GRCm39) unclassified probably benign
R0090:Chaf1b UTSW 16 93,684,012 (GRCm39) missense possibly damaging 0.52
R0309:Chaf1b UTSW 16 93,681,399 (GRCm39) missense probably damaging 0.96
R0690:Chaf1b UTSW 16 93,696,905 (GRCm39) splice site probably benign
R1494:Chaf1b UTSW 16 93,684,998 (GRCm39) missense probably damaging 1.00
R1572:Chaf1b UTSW 16 93,698,118 (GRCm39) missense possibly damaging 0.77
R1595:Chaf1b UTSW 16 93,701,987 (GRCm39) critical splice donor site probably null
R1654:Chaf1b UTSW 16 93,691,791 (GRCm39) missense probably damaging 0.97
R2057:Chaf1b UTSW 16 93,691,795 (GRCm39) missense probably damaging 1.00
R2280:Chaf1b UTSW 16 93,688,459 (GRCm39) missense probably damaging 1.00
R2406:Chaf1b UTSW 16 93,697,043 (GRCm39) missense probably damaging 0.99
R2655:Chaf1b UTSW 16 93,688,399 (GRCm39) missense probably damaging 0.99
R4522:Chaf1b UTSW 16 93,698,183 (GRCm39) missense probably benign 0.05
R4605:Chaf1b UTSW 16 93,684,977 (GRCm39) missense possibly damaging 0.90
R4686:Chaf1b UTSW 16 93,681,472 (GRCm39) missense probably benign 0.00
R4784:Chaf1b UTSW 16 93,681,430 (GRCm39) missense probably damaging 1.00
R4862:Chaf1b UTSW 16 93,684,022 (GRCm39) missense probably damaging 0.99
R5603:Chaf1b UTSW 16 93,689,683 (GRCm39) missense probably damaging 1.00
R5683:Chaf1b UTSW 16 93,684,030 (GRCm39) missense possibly damaging 0.90
R6763:Chaf1b UTSW 16 93,688,393 (GRCm39) missense probably damaging 1.00
R6940:Chaf1b UTSW 16 93,702,853 (GRCm39) missense probably benign 0.00
R7862:Chaf1b UTSW 16 93,684,983 (GRCm39) missense possibly damaging 0.90
R7980:Chaf1b UTSW 16 93,681,415 (GRCm39) missense probably damaging 1.00
R8083:Chaf1b UTSW 16 93,691,630 (GRCm39) missense probably damaging 0.96
R8841:Chaf1b UTSW 16 93,701,908 (GRCm39) missense probably benign 0.00
R9387:Chaf1b UTSW 16 93,689,629 (GRCm39) missense probably benign 0.28
R9467:Chaf1b UTSW 16 93,681,394 (GRCm39) missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- ATGATAGCCAGTACTCCGGTACC -3'
(R):5'- TGTCCATTTACCCTGACGGC -3'

Sequencing Primer
(F):5'- GGTACCGGTCTCTGGGAC -3'
(R):5'- ATTTACCCTGACGGCGGTGTC -3'
Posted On 2019-09-13