Incidental Mutation 'R7401:Vmn2r111'
ID 574203
Institutional Source Beutler Lab
Gene Symbol Vmn2r111
Ensembl Gene ENSMUSG00000095093
Gene Name vomeronasal 2, receptor 111
Synonyms EG210876
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.132) question?
Stock # R7401 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 22547941-22573273 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 22571086 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Lysine at position 313 (T313K)
Ref Sequence ENSEMBL: ENSMUSP00000090148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092491]
AlphaFold K7N674
Predicted Effect possibly damaging
Transcript: ENSMUST00000092491
AA Change: T313K

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000090148
Gene: ENSMUSG00000095093
AA Change: T313K

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 469 2.5e-29 PFAM
Pfam:NCD3G 512 565 1.1e-20 PFAM
Pfam:7tm_3 595 833 5.6e-54 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610318N02Rik A T 16: 17,118,404 L152Q probably benign Het
Abcg3 A T 5: 104,966,774 N292K probably damaging Het
Adamts3 T A 5: 89,707,450 probably null Het
Adgrg7 T C 16: 56,742,418 N519D probably benign Het
Adsl A G 15: 80,962,782 H263R probably damaging Het
Ak9 A T 10: 41,423,004 D1567V unknown Het
Bscl2 T C 19: 8,846,550 F280L possibly damaging Het
Cacna1b T A 2: 24,679,294 T873S probably benign Het
Cacna1c T C 6: 119,052,708 probably null Het
Cast G T 13: 74,808,458 A18E unknown Het
Ccdc114 A C 7: 45,942,765 Q323P probably damaging Het
Cd207 A C 6: 83,677,848 probably benign Het
Cd79b A G 11: 106,312,852 S130P probably benign Het
Cfap52 A T 11: 67,949,633 N157K probably benign Het
Cfap57 C T 4: 118,614,931 V84I probably benign Het
Chaf1b G T 16: 93,884,380 probably benign Het
Cntn1 A G 15: 92,317,989 I968V probably benign Het
Cntn5 C T 9: 9,833,461 V362I probably benign Het
Crem A G 18: 3,295,329 S80P probably damaging Het
Csnk1g3 C T 18: 53,930,318 T267I probably damaging Het
Cyth1 A T 11: 118,182,251 N274K possibly damaging Het
Dicer1 C T 12: 104,712,278 G594S probably benign Het
Enpp1 C T 10: 24,645,282 C849Y probably damaging Het
Fam193a A G 5: 34,465,635 E1189G possibly damaging Het
Fermt1 C A 2: 132,917,559 V426L probably benign Het
Fes A G 7: 80,378,776 probably null Het
Gm16486 T C 8: 70,717,272 I1337T probably benign Het
Gmeb1 C A 4: 132,225,774 L560F probably damaging Het
Hace1 T C 10: 45,670,626 L452P probably damaging Het
Hecw2 T A 1: 53,904,343 H975L probably damaging Het
Idh2 GGTCCCAG GG 7: 80,098,329 probably benign Het
Il1r2 T A 1: 40,123,210 C338S probably damaging Het
Kcnb1 T C 2: 167,188,284 S114G probably damaging Het
Lce1c A T 3: 92,680,316 T17S unknown Het
Lhfpl4 C A 6: 113,176,666 L141F possibly damaging Het
Ms4a14 T C 19: 11,302,230 E988G possibly damaging Het
Naip5 T C 13: 100,219,696 Q1137R probably benign Het
Naip5 G T 13: 100,219,697 Q1137K not run Het
Neurod1 T A 2: 79,454,946 D31V probably benign Het
Neurod4 A G 10: 130,271,058 C116R probably damaging Het
Nisch A G 14: 31,206,580 V28A probably benign Het
Olfr1174-ps T G 2: 88,311,428 M123L probably benign Het
Olfr1245 A G 2: 89,575,105 V207A probably benign Het
Pabpc4l A T 3: 46,446,252 I319N probably damaging Het
Pabpc4l T A 3: 46,446,589 R207W probably damaging Het
Pcm1 G A 8: 41,309,531 D1371N probably damaging Het
Peg10 G GGTC 6: 4,756,452 probably benign Het
Plxnc1 C T 10: 94,871,005 A557T probably benign Het
Prkdc T A 16: 15,648,738 V58D probably damaging Het
Prpf40a A G 2: 53,156,947 V259A probably benign Het
Psmd3 A T 11: 98,685,640 T123S probably benign Het
Ptgr2 G T 12: 84,292,329 probably benign Het
Ptprr A G 10: 116,048,236 H66R probably benign Het
Rftn2 A G 1: 55,194,242 probably null Het
Rsph14 T A 10: 75,029,796 E70V possibly damaging Het
Slc24a5 G A 2: 125,088,191 V471I probably benign Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Spag9 A T 11: 94,097,689 T862S probably benign Het
Ssbp2 T A 13: 91,690,883 D291E probably benign Het
Supt5 T C 7: 28,323,772 K329E probably damaging Het
Syne2 G T 12: 75,967,381 K3115N probably damaging Het
Tars A T 15: 11,392,009 L239* probably null Het
Tbxa2r T C 10: 81,332,791 Y105H probably benign Het
Tesk1 T A 4: 43,445,743 D265E probably damaging Het
Tril T C 6: 53,818,281 D652G possibly damaging Het
Tsga10 T C 1: 37,834,187 R204G probably null Het
Twnk A G 19: 45,011,780 D645G probably benign Het
Umodl1 A T 17: 30,998,148 D1118V probably damaging Het
Unc119 T C 11: 78,347,245 I83T probably benign Het
Unc80 T C 1: 66,646,415 W2233R possibly damaging Het
Vmn1r45 T A 6: 89,933,434 T185S possibly damaging Het
Wdr4 A G 17: 31,509,832 L123S probably damaging Het
Zfpm2 A G 15: 41,102,990 E957G possibly damaging Het
Other mutations in Vmn2r111
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00932:Vmn2r111 APN 17 22548753 missense probably benign 0.00
IGL01306:Vmn2r111 APN 17 22568984 missense probably damaging 0.99
IGL01309:Vmn2r111 APN 17 22569016 missense possibly damaging 0.51
IGL01457:Vmn2r111 APN 17 22571985 nonsense probably null
IGL01465:Vmn2r111 APN 17 22548737 missense probably benign 0.00
IGL01505:Vmn2r111 APN 17 22548572 missense probably benign 0.00
IGL01571:Vmn2r111 APN 17 22571392 missense probably damaging 0.99
IGL01715:Vmn2r111 APN 17 22569073 splice site probably benign
IGL01962:Vmn2r111 APN 17 22548284 missense possibly damaging 0.90
IGL02190:Vmn2r111 APN 17 22570773 missense probably benign 0.00
IGL02496:Vmn2r111 APN 17 22568856 missense probably benign
IGL02519:Vmn2r111 APN 17 22548339 missense possibly damaging 0.80
IGL02616:Vmn2r111 APN 17 22571050 missense possibly damaging 0.67
IGL02641:Vmn2r111 APN 17 22573224 missense possibly damaging 0.82
IGL02690:Vmn2r111 APN 17 22559042 critical splice donor site probably null
IGL02698:Vmn2r111 APN 17 22571245 missense probably damaging 1.00
IGL03017:Vmn2r111 APN 17 22570858 missense probably damaging 1.00
R0046:Vmn2r111 UTSW 17 22548009 missense probably benign
R0064:Vmn2r111 UTSW 17 22572072 missense probably benign 0.00
R0519:Vmn2r111 UTSW 17 22573121 missense probably benign 0.02
R1439:Vmn2r111 UTSW 17 22571116 missense probably benign 0.00
R1467:Vmn2r111 UTSW 17 22571047 missense probably damaging 0.99
R1467:Vmn2r111 UTSW 17 22571047 missense probably damaging 0.99
R1636:Vmn2r111 UTSW 17 22571399 missense probably damaging 1.00
R1647:Vmn2r111 UTSW 17 22569061 missense probably benign 0.03
R1648:Vmn2r111 UTSW 17 22569061 missense probably benign 0.03
R1697:Vmn2r111 UTSW 17 22548060 missense probably benign 0.26
R1996:Vmn2r111 UTSW 17 22548081 missense probably benign 0.21
R2040:Vmn2r111 UTSW 17 22548414 missense probably damaging 1.00
R2075:Vmn2r111 UTSW 17 22559062 missense probably damaging 1.00
R2134:Vmn2r111 UTSW 17 22573104 missense possibly damaging 0.68
R2357:Vmn2r111 UTSW 17 22559170 splice site probably benign
R3700:Vmn2r111 UTSW 17 22571161 nonsense probably null
R3782:Vmn2r111 UTSW 17 22571320 missense possibly damaging 0.89
R4085:Vmn2r111 UTSW 17 22559115 missense probably benign 0.00
R4323:Vmn2r111 UTSW 17 22573178 missense probably benign 0.02
R4900:Vmn2r111 UTSW 17 22548656 missense possibly damaging 0.94
R5072:Vmn2r111 UTSW 17 22548041 missense probably damaging 0.99
R5123:Vmn2r111 UTSW 17 22571143 missense possibly damaging 0.82
R5181:Vmn2r111 UTSW 17 22571020 missense possibly damaging 0.56
R5357:Vmn2r111 UTSW 17 22548102 nonsense probably null
R5398:Vmn2r111 UTSW 17 22573271 start codon destroyed probably null 0.88
R5434:Vmn2r111 UTSW 17 22548489 missense probably damaging 0.99
R5462:Vmn2r111 UTSW 17 22548257 missense probably damaging 1.00
R6149:Vmn2r111 UTSW 17 22548815 missense probably benign 0.00
R6149:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6207:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6281:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6282:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6283:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6307:Vmn2r111 UTSW 17 22573089 missense probably benign 0.00
R6323:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6325:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6367:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6368:Vmn2r111 UTSW 17 22571908 missense probably benign 0.38
R6369:Vmn2r111 UTSW 17 22548602 missense probably damaging 1.00
R6489:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6490:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6546:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6547:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6557:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6654:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6655:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6657:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6659:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6660:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6664:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6798:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6799:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6801:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6893:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6895:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6897:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6922:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6923:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6944:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6945:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7017:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7018:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7024:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7031:Vmn2r111 UTSW 17 22571245 missense probably damaging 1.00
R7039:Vmn2r111 UTSW 17 22548184 missense probably damaging 1.00
R7053:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7054:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7055:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7056:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7145:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7146:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7246:Vmn2r111 UTSW 17 22548714 missense probably damaging 1.00
R7259:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7260:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7327:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7514:Vmn2r111 UTSW 17 22548399 missense probably benign 0.05
R7651:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7781:Vmn2r111 UTSW 17 22570733 missense probably benign 0.17
R7816:Vmn2r111 UTSW 17 22573102 missense probably damaging 0.97
R7821:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7838:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R8078:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R8080:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R8117:Vmn2r111 UTSW 17 22571488 missense probably benign 0.12
R8171:Vmn2r111 UTSW 17 22573092 missense probably benign 0.10
R8195:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R8197:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R8411:Vmn2r111 UTSW 17 22548581 missense probably benign 0.03
R8539:Vmn2r111 UTSW 17 22571293 missense probably benign 0.23
R8540:Vmn2r111 UTSW 17 22559042 critical splice donor site probably null
R8540:Vmn2r111 UTSW 17 22559043 missense probably damaging 1.00
R8557:Vmn2r111 UTSW 17 22571929 nonsense probably null
R8720:Vmn2r111 UTSW 17 22573213 missense possibly damaging 0.88
R8729:Vmn2r111 UTSW 17 22548258 missense probably damaging 1.00
R8843:Vmn2r111 UTSW 17 22548030 missense probably benign 0.00
R9184:Vmn2r111 UTSW 17 22571841 missense probably benign
R9374:Vmn2r111 UTSW 17 22568878 missense probably benign 0.17
R9452:Vmn2r111 UTSW 17 22559151 missense probably damaging 1.00
X0026:Vmn2r111 UTSW 17 22548695 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GATGAGCAGTTCTTCAGTGTCTTAC -3'
(R):5'- TGCCTTTGTCAACATGATTCCAG -3'

Sequencing Primer
(F):5'- CATTTAGATGCTGAGACCTCACAG -3'
(R):5'- GTCAACATGATTCCAGTCAACATG -3'
Posted On 2019-09-13