Incidental Mutation 'R7401:Bscl2'
ID 574208
Institutional Source Beutler Lab
Gene Symbol Bscl2
Ensembl Gene ENSMUSG00000071657
Gene Name BSCL2 lipid droplet biogenesis associated, seipin
Synonyms seipin, Gng3lg
MMRRC Submission 045483-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7401 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 8814831-8826047 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 8823914 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 280 (F280L)
Ref Sequence ENSEMBL: ENSMUSP00000127685 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086058] [ENSMUST00000096257] [ENSMUST00000159634] [ENSMUST00000159653] [ENSMUST00000160556] [ENSMUST00000160897] [ENSMUST00000171649]
AlphaFold Q9Z2E9
Predicted Effect possibly damaging
Transcript: ENSMUST00000086058
AA Change: F220L

PolyPhen 2 Score 0.934 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000083224
Gene: ENSMUSG00000071657
AA Change: F220L

DomainStartEndE-ValueType
Pfam:Seipin 37 243 3.9e-71 PFAM
Blast:PAC 269 306 4e-7 BLAST
low complexity region 353 371 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000096257
SMART Domains Protein: ENSMUSP00000093976
Gene: ENSMUSG00000071656

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
FN3 83 162 2.81e-5 SMART
transmembrane domain 194 216 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000159634
AA Change: F220L

PolyPhen 2 Score 0.934 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000125422
Gene: ENSMUSG00000071657
AA Change: F220L

DomainStartEndE-ValueType
Pfam:Seipin 37 243 3.9e-71 PFAM
Blast:PAC 269 306 4e-7 BLAST
low complexity region 353 371 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000159653
AA Change: F74L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123920
Gene: ENSMUSG00000071657
AA Change: F74L

DomainStartEndE-ValueType
Pfam:Seipin 1 97 1.2e-33 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000160556
AA Change: F220L

PolyPhen 2 Score 0.934 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000123976
Gene: ENSMUSG00000071657
AA Change: F220L

DomainStartEndE-ValueType
Pfam:Seipin 37 243 3.9e-71 PFAM
Blast:PAC 269 306 4e-7 BLAST
low complexity region 353 371 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160897
SMART Domains Protein: ENSMUSP00000125250
Gene: ENSMUSG00000071657

DomainStartEndE-ValueType
Pfam:Seipin 97 208 2.8e-34 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000171649
AA Change: F280L

PolyPhen 2 Score 0.567 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000127685
Gene: ENSMUSG00000071657
AA Change: F280L

DomainStartEndE-ValueType
Pfam:Seipin 99 302 8.5e-66 PFAM
Blast:PAC 329 366 2e-6 BLAST
low complexity region 413 431 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the multi-pass transmembrane protein protein seipin. This protein localizes to the endoplasmic reticulum and may be important for lipid droplet morphology. Mutations in this gene have been associated with congenital generalized lipodystrophy type 2 or Berardinelli-Seip syndrome, a rare autosomal recessive disease characterized by a near absence of adipose tissue and severe insulin resistance. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. Naturally occurring read-through transcription occurs between this locus and the neighboring locus HNRNPUL2 (heterogeneous nuclear ribonucleoprotein U-like 2).[provided by RefSeq, Mar 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit severe generalized lipodystrophy with hepatic steatosis, glucose intolerance, and insulin resistance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610318N02Rik A T 16: 16,936,268 (GRCm39) L152Q probably benign Het
Abcg3 A T 5: 105,114,640 (GRCm39) N292K probably damaging Het
Adamts3 T A 5: 89,855,309 (GRCm39) probably null Het
Adgrg7 T C 16: 56,562,781 (GRCm39) N519D probably benign Het
Adsl A G 15: 80,846,983 (GRCm39) H263R probably damaging Het
Ak9 A T 10: 41,299,000 (GRCm39) D1567V unknown Het
Cacna1b T A 2: 24,569,306 (GRCm39) T873S probably benign Het
Cacna1c T C 6: 119,029,669 (GRCm39) probably null Het
Cast G T 13: 74,956,577 (GRCm39) A18E unknown Het
Cd207 A C 6: 83,654,830 (GRCm39) probably benign Het
Cd79b A G 11: 106,203,678 (GRCm39) S130P probably benign Het
Cfap52 A T 11: 67,840,459 (GRCm39) N157K probably benign Het
Cfap57 C T 4: 118,472,128 (GRCm39) V84I probably benign Het
Chaf1b G T 16: 93,681,268 (GRCm39) probably benign Het
Cntn1 A G 15: 92,215,870 (GRCm39) I968V probably benign Het
Cntn5 C T 9: 9,833,466 (GRCm39) V362I probably benign Het
Crem A G 18: 3,295,329 (GRCm39) S80P probably damaging Het
Csnk1g3 C T 18: 54,063,390 (GRCm39) T267I probably damaging Het
Cyth1 A T 11: 118,073,077 (GRCm39) N274K possibly damaging Het
Dicer1 C T 12: 104,678,537 (GRCm39) G594S probably benign Het
Enpp1 C T 10: 24,521,180 (GRCm39) C849Y probably damaging Het
Fam193a A G 5: 34,622,979 (GRCm39) E1189G possibly damaging Het
Fermt1 C A 2: 132,759,479 (GRCm39) V426L probably benign Het
Fes A G 7: 80,028,524 (GRCm39) probably null Het
Gmeb1 C A 4: 131,953,085 (GRCm39) L560F probably damaging Het
Hace1 T C 10: 45,546,722 (GRCm39) L452P probably damaging Het
Hecw2 T A 1: 53,943,502 (GRCm39) H975L probably damaging Het
Idh2 GGTCCCAG GG 7: 79,748,077 (GRCm39) probably benign Het
Il1r2 T A 1: 40,162,370 (GRCm39) C338S probably damaging Het
Iqcn T C 8: 71,169,921 (GRCm39) I1337T probably benign Het
Kcnb1 T C 2: 167,030,204 (GRCm39) S114G probably damaging Het
Lce1c A T 3: 92,587,623 (GRCm39) T17S unknown Het
Lhfpl4 C A 6: 113,153,627 (GRCm39) L141F possibly damaging Het
Ms4a14 T C 19: 11,279,594 (GRCm39) E988G possibly damaging Het
Naip5 T C 13: 100,356,204 (GRCm39) Q1137R probably benign Het
Naip5 G T 13: 100,356,205 (GRCm39) Q1137K not run Het
Neurod1 T A 2: 79,285,290 (GRCm39) D31V probably benign Het
Neurod4 A G 10: 130,106,927 (GRCm39) C116R probably damaging Het
Nisch A G 14: 30,928,537 (GRCm39) V28A probably benign Het
Odad1 A C 7: 45,592,189 (GRCm39) Q323P probably damaging Het
Or4a72 A G 2: 89,405,449 (GRCm39) V207A probably benign Het
Or5d44 T G 2: 88,141,772 (GRCm39) M123L probably benign Het
Pabpc4l T A 3: 46,401,024 (GRCm39) R207W probably damaging Het
Pabpc4l A T 3: 46,400,687 (GRCm39) I319N probably damaging Het
Pcm1 G A 8: 41,762,568 (GRCm39) D1371N probably damaging Het
Peg10 G GGTC 6: 4,756,452 (GRCm39) probably benign Het
Plxnc1 C T 10: 94,706,867 (GRCm39) A557T probably benign Het
Prkdc T A 16: 15,466,602 (GRCm39) V58D probably damaging Het
Prpf40a A G 2: 53,046,959 (GRCm39) V259A probably benign Het
Psmd3 A T 11: 98,576,466 (GRCm39) T123S probably benign Het
Ptgr2 G T 12: 84,339,103 (GRCm39) probably benign Het
Ptprr A G 10: 115,884,141 (GRCm39) H66R probably benign Het
Rftn2 A G 1: 55,233,401 (GRCm39) probably null Het
Rsph14 T A 10: 74,865,628 (GRCm39) E70V possibly damaging Het
Slc24a5 G A 2: 124,930,111 (GRCm39) V471I probably benign Het
Sorbs1 G C 19: 40,365,244 (GRCm39) R180G probably benign Het
Spag9 A T 11: 93,988,515 (GRCm39) T862S probably benign Het
Ssbp2 T A 13: 91,839,002 (GRCm39) D291E probably benign Het
Supt5 T C 7: 28,023,197 (GRCm39) K329E probably damaging Het
Syne2 G T 12: 76,014,155 (GRCm39) K3115N probably damaging Het
Tars1 A T 15: 11,392,095 (GRCm39) L239* probably null Het
Tbxa2r T C 10: 81,168,625 (GRCm39) Y105H probably benign Het
Tesk1 T A 4: 43,445,743 (GRCm39) D265E probably damaging Het
Tril T C 6: 53,795,266 (GRCm39) D652G possibly damaging Het
Tsga10 T C 1: 37,873,268 (GRCm39) R204G probably null Het
Twnk A G 19: 45,000,219 (GRCm39) D645G probably benign Het
Umodl1 A T 17: 31,217,122 (GRCm39) D1118V probably damaging Het
Unc119 T C 11: 78,238,071 (GRCm39) I83T probably benign Het
Unc80 T C 1: 66,685,574 (GRCm39) W2233R possibly damaging Het
Vmn1r45 T A 6: 89,910,416 (GRCm39) T185S possibly damaging Het
Vmn2r111 G T 17: 22,790,067 (GRCm39) T313K possibly damaging Het
Wdr4 A G 17: 31,728,806 (GRCm39) L123S probably damaging Het
Zfpm2 A G 15: 40,966,386 (GRCm39) E957G possibly damaging Het
Other mutations in Bscl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01908:Bscl2 APN 19 8,822,640 (GRCm39) missense probably damaging 0.99
IGL03206:Bscl2 APN 19 8,820,453 (GRCm39) missense probably damaging 0.97
R0193:Bscl2 UTSW 19 8,824,793 (GRCm39) missense probably benign 0.21
R1112:Bscl2 UTSW 19 8,817,098 (GRCm39) missense possibly damaging 0.90
R1513:Bscl2 UTSW 19 8,818,509 (GRCm39) missense probably damaging 1.00
R2049:Bscl2 UTSW 19 8,822,684 (GRCm39) splice site probably null
R2121:Bscl2 UTSW 19 8,817,146 (GRCm39) nonsense probably null
R2140:Bscl2 UTSW 19 8,822,684 (GRCm39) splice site probably null
R2142:Bscl2 UTSW 19 8,822,684 (GRCm39) splice site probably null
R2483:Bscl2 UTSW 19 8,818,514 (GRCm39) missense probably benign 0.01
R3623:Bscl2 UTSW 19 8,818,514 (GRCm39) missense probably benign 0.01
R4177:Bscl2 UTSW 19 8,817,120 (GRCm39) missense possibly damaging 0.85
R4675:Bscl2 UTSW 19 8,825,523 (GRCm39) missense possibly damaging 0.81
R4967:Bscl2 UTSW 19 8,825,344 (GRCm39) missense probably benign 0.02
R5051:Bscl2 UTSW 19 8,822,643 (GRCm39) nonsense probably null
R5446:Bscl2 UTSW 19 8,823,564 (GRCm39) missense possibly damaging 0.91
R6493:Bscl2 UTSW 19 8,817,138 (GRCm39) missense probably damaging 1.00
R6838:Bscl2 UTSW 19 8,818,745 (GRCm39) missense probably damaging 1.00
R7117:Bscl2 UTSW 19 8,825,878 (GRCm39) missense possibly damaging 0.68
R7923:Bscl2 UTSW 19 8,824,883 (GRCm39) missense probably benign 0.00
R8249:Bscl2 UTSW 19 8,823,884 (GRCm39) missense probably damaging 1.00
R8332:Bscl2 UTSW 19 8,823,594 (GRCm39) missense probably benign 0.23
R8748:Bscl2 UTSW 19 8,825,311 (GRCm39) missense probably damaging 0.99
R8870:Bscl2 UTSW 19 8,824,793 (GRCm39) missense probably benign 0.02
R8926:Bscl2 UTSW 19 8,825,348 (GRCm39) critical splice donor site probably null
R9249:Bscl2 UTSW 19 8,820,378 (GRCm39) missense probably damaging 1.00
R9691:Bscl2 UTSW 19 8,817,110 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- GAATTCGGTAAGTGGCTGACAG -3'
(R):5'- CTCTTGAAAGGTGACAAGCAC -3'

Sequencing Primer
(F):5'- CTGACAGAGTTAGGAGACAACTCTTC -3'
(R):5'- TGACAAGCACAGTGAAGCC -3'
Posted On 2019-09-13