Mutagenetix > Incidental Mutation

Incidental Mutation 'R7401:Sorbs1'

574210

Institutional Source

Beutler Lab

Gene Symbol

Sorbs1

Ensembl Gene

ENSMUSG00000025006

Gene Name

sorbin and SH3 domain containing 1

Synonyms

9530001P15Rik, 2310065E01Rik, Ponsin, Sh3d5, CAP, c-Cbl-associated protein

MMRRC Submission

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.711) question?

Stock #

R7401 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

40294753-40513779 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to C at 40376800 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glycine at position 180 (R180G)

Ref Sequence

ENSEMBL: ENSMUSP00000153313 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099466] [ENSMUST00000099467] [ENSMUST00000165212] [ENSMUST00000165469] [ENSMUST00000224233] [ENSMUST00000224247] [ENSMUST00000224583] [ENSMUST00000224667] [ENSMUST00000225148] [ENSMUST00000225153] [ENSMUST00000225786] [ENSMUST00000226047]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000099466

SMART Domains

Protein: ENSMUSP00000097065
Gene: ENSMUSG00000025006

Domain	Start	End	E-Value	Type
low complexity region	45	63	N/A	INTRINSIC
Sorb	203	249	1.07e-26	SMART
SH3	502	557	2.72e-18	SMART
SH3	576	633	9.32e-17	SMART
low complexity region	647	660	N/A	INTRINSIC
SH3	682	739	3.7e-20	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000099467
AA Change: R180G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000097066
Gene: ENSMUSG00000025006
AA Change: R180G

Domain	Start	End	E-Value	Type
low complexity region	45	63	N/A	INTRINSIC
low complexity region	192	213	N/A	INTRINSIC
Sorb	327	373	1.24e-22	SMART
coiled coil region	558	584	N/A	INTRINSIC
SH3	700	755	2.72e-18	SMART
SH3	774	831	9.32e-17	SMART
low complexity region	845	858	N/A	INTRINSIC
SH3	880	937	3.7e-20	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000165212

SMART Domains

Protein: ENSMUSP00000126460
Gene: ENSMUSG00000025006

Domain	Start	End	E-Value	Type
low complexity region	45	63	N/A	INTRINSIC
Sorb	193	239	1.07e-26	SMART
SH3	486	541	2.72e-18	SMART
SH3	560	617	9.32e-17	SMART
low complexity region	631	644	N/A	INTRINSIC
SH3	666	723	3.7e-20	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000165469

SMART Domains

Protein: ENSMUSP00000125768
Gene: ENSMUSG00000025006

Domain	Start	End	E-Value	Type
low complexity region	75	93	N/A	INTRINSIC
Sorb	233	279	1.07e-26	SMART
SH3	476	531	2.72e-18	SMART
SH3	550	607	9.32e-17	SMART
low complexity region	621	634	N/A	INTRINSIC
SH3	656	713	3.7e-20	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000224233

Predicted Effect

probably benign
Transcript: ENSMUST00000224247

Predicted Effect

probably benign
Transcript: ENSMUST00000224583

Predicted Effect

probably benign
Transcript: ENSMUST00000224667

Predicted Effect

probably benign
Transcript: ENSMUST00000225148

Predicted Effect

probably benign
Transcript: ENSMUST00000225153
AA Change: R180G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000225786

Predicted Effect

probably benign
Transcript: ENSMUST00000226047

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a CBL-associated protein which functions in the signaling and stimulation of insulin. Mutations in this gene may be associated with human disorders of insulin resistance. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased triglyceride levels, altered glucose homeostasis, decreased white blood cells and resistance to developing glucose intolerance induced by a high fat diet. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610318N02Rik	A	T	16: 17,118,404	L152Q	probably benign	Het
Abcg3	A	T	5: 104,966,774	N292K	probably damaging	Het
Adamts3	T	A	5: 89,707,450		probably null	Het
Adgrg7	T	C	16: 56,742,418	N519D	probably benign	Het
Adsl	A	G	15: 80,962,782	H263R	probably damaging	Het
Ak9	A	T	10: 41,423,004	D1567V	unknown	Het
Bscl2	T	C	19: 8,846,550	F280L	possibly damaging	Het
Cacna1b	T	A	2: 24,679,294	T873S	probably benign	Het
Cacna1c	T	C	6: 119,052,708		probably null	Het
Cast	G	T	13: 74,808,458	A18E	unknown	Het
Ccdc114	A	C	7: 45,942,765	Q323P	probably damaging	Het
Cd207	A	C	6: 83,677,848		probably benign	Het
Cd79b	A	G	11: 106,312,852	S130P	probably benign	Het
Cfap52	A	T	11: 67,949,633	N157K	probably benign	Het
Cfap57	C	T	4: 118,614,931	V84I	probably benign	Het
Chaf1b	G	T	16: 93,884,380		probably benign	Het
Cntn1	A	G	15: 92,317,989	I968V	probably benign	Het
Cntn5	C	T	9: 9,833,461	V362I	probably benign	Het
Crem	A	G	18: 3,295,329	S80P	probably damaging	Het
Csnk1g3	C	T	18: 53,930,318	T267I	probably damaging	Het
Cyth1	A	T	11: 118,182,251	N274K	possibly damaging	Het
Dicer1	C	T	12: 104,712,278	G594S	probably benign	Het
Enpp1	C	T	10: 24,645,282	C849Y	probably damaging	Het
Fam193a	A	G	5: 34,465,635	E1189G	possibly damaging	Het
Fermt1	C	A	2: 132,917,559	V426L	probably benign	Het
Fes	A	G	7: 80,378,776		probably null	Het
Gm16486	T	C	8: 70,717,272	I1337T	probably benign	Het
Gmeb1	C	A	4: 132,225,774	L560F	probably damaging	Het
Hace1	T	C	10: 45,670,626	L452P	probably damaging	Het
Hecw2	T	A	1: 53,904,343	H975L	probably damaging	Het
Idh2	GGTCCCAG	GG	7: 80,098,329		probably benign	Het
Il1r2	T	A	1: 40,123,210	C338S	probably damaging	Het
Kcnb1	T	C	2: 167,188,284	S114G	probably damaging	Het
Lce1c	A	T	3: 92,680,316	T17S	unknown	Het
Lhfpl4	C	A	6: 113,176,666	L141F	possibly damaging	Het
Ms4a14	T	C	19: 11,302,230	E988G	possibly damaging	Het
Naip5	T	C	13: 100,219,696	Q1137R	probably benign	Het
Naip5	G	T	13: 100,219,697	Q1137K	not run	Het
Neurod1	T	A	2: 79,454,946	D31V	probably benign	Het
Neurod4	A	G	10: 130,271,058	C116R	probably damaging	Het
Nisch	A	G	14: 31,206,580	V28A	probably benign	Het
Olfr1174-ps	T	G	2: 88,311,428	M123L	probably benign	Het
Olfr1245	A	G	2: 89,575,105	V207A	probably benign	Het
Pabpc4l	A	T	3: 46,446,252	I319N	probably damaging	Het
Pabpc4l	T	A	3: 46,446,589	R207W	probably damaging	Het
Pcm1	G	A	8: 41,309,531	D1371N	probably damaging	Het
Peg10	G	GGTC	6: 4,756,452		probably benign	Het
Plxnc1	C	T	10: 94,871,005	A557T	probably benign	Het
Prkdc	T	A	16: 15,648,738	V58D	probably damaging	Het
Prpf40a	A	G	2: 53,156,947	V259A	probably benign	Het
Psmd3	A	T	11: 98,685,640	T123S	probably benign	Het
Ptgr2	G	T	12: 84,292,329		probably benign	Het
Ptprr	A	G	10: 116,048,236	H66R	probably benign	Het
Rftn2	A	G	1: 55,194,242		probably null	Het
Rsph14	T	A	10: 75,029,796	E70V	possibly damaging	Het
Slc24a5	G	A	2: 125,088,191	V471I	probably benign	Het
Spag9	A	T	11: 94,097,689	T862S	probably benign	Het
Ssbp2	T	A	13: 91,690,883	D291E	probably benign	Het
Supt5	T	C	7: 28,323,772	K329E	probably damaging	Het
Syne2	G	T	12: 75,967,381	K3115N	probably damaging	Het
Tars	A	T	15: 11,392,009	L239*	probably null	Het
Tbxa2r	T	C	10: 81,332,791	Y105H	probably benign	Het
Tesk1	T	A	4: 43,445,743	D265E	probably damaging	Het
Tril	T	C	6: 53,818,281	D652G	possibly damaging	Het
Tsga10	T	C	1: 37,834,187	R204G	probably null	Het
Twnk	A	G	19: 45,011,780	D645G	probably benign	Het
Umodl1	A	T	17: 30,998,148	D1118V	probably damaging	Het
Unc119	T	C	11: 78,347,245	I83T	probably benign	Het
Unc80	T	C	1: 66,646,415	W2233R	possibly damaging	Het
Vmn1r45	T	A	6: 89,933,434	T185S	possibly damaging	Het
Vmn2r111	G	T	17: 22,571,086	T313K	possibly damaging	Het
Wdr4	A	G	17: 31,509,832	L123S	probably damaging	Het
Zfpm2	A	G	15: 41,102,990	E957G	possibly damaging	Het

Other mutations in Sorbs1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00160:Sorbs1	APN	19	40318029	missense	probably damaging	1.00
IGL00776:Sorbs1	APN	19	40344351	splice site	probably null
IGL00788:Sorbs1	APN	19	40337043	splice site	probably benign
IGL00943:Sorbs1	APN	19	40295040	utr 3 prime	probably benign
IGL01525:Sorbs1	APN	19	40349978	missense	probably damaging	1.00
IGL01530:Sorbs1	APN	19	40376647	missense	probably benign	0.01
IGL01951:Sorbs1	APN	19	40318016	splice site	probably benign
IGL02159:Sorbs1	APN	19	40327596	missense	probably damaging	0.96
IGL02252:Sorbs1	APN	19	40314397	missense	probably damaging	1.00
IGL02613:Sorbs1	APN	19	40327547	missense	probably damaging	1.00
IGL02643:Sorbs1	APN	19	40365133	missense	possibly damaging	0.65
IGL02668:Sorbs1	APN	19	40314681	missense	probably damaging	1.00
IGL02738:Sorbs1	APN	19	40376904	missense	probably damaging	0.97
IGL02965:Sorbs1	APN	19	40376743	missense	probably benign	0.01
IGL03083:Sorbs1	APN	19	40314376	missense	probably damaging	1.00
IGL03173:Sorbs1	APN	19	40363262	missense	probably damaging	1.00
IGL03286:Sorbs1	APN	19	40344414	missense	probably damaging	0.99
IGL03292:Sorbs1	APN	19	40373565	missense	possibly damaging	0.79
R0016:Sorbs1	UTSW	19	40314738	splice site	probably benign
R0016:Sorbs1	UTSW	19	40314738	splice site	probably benign
R0306:Sorbs1	UTSW	19	40344411	missense	possibly damaging	0.94
R0526:Sorbs1	UTSW	19	40349948	missense	probably damaging	1.00
R0551:Sorbs1	UTSW	19	40311816	missense	probably damaging	1.00
R0688:Sorbs1	UTSW	19	40363262	missense	probably damaging	1.00
R1185:Sorbs1	UTSW	19	40382606	missense	probably damaging	1.00
R1185:Sorbs1	UTSW	19	40382606	missense	probably damaging	1.00
R1185:Sorbs1	UTSW	19	40382606	missense	probably damaging	1.00
R1891:Sorbs1	UTSW	19	40393460	missense	probably damaging	0.99
R2066:Sorbs1	UTSW	19	40365028	splice site	probably null
R2148:Sorbs1	UTSW	19	40376824	missense	possibly damaging	0.94
R2214:Sorbs1	UTSW	19	40296631	missense	probably damaging	1.00
R2410:Sorbs1	UTSW	19	40373515	missense	probably damaging	0.99
R2940:Sorbs1	UTSW	19	40373571	missense	probably damaging	1.00
R3847:Sorbs1	UTSW	19	40314443	missense	probably damaging	0.97
R4405:Sorbs1	UTSW	19	40395745	missense	probably benign	0.03
R4544:Sorbs1	UTSW	19	40311850	missense	probably damaging	0.99
R4618:Sorbs1	UTSW	19	40373518	missense	probably damaging	0.99
R4731:Sorbs1	UTSW	19	40314689	missense	probably benign	0.29
R4732:Sorbs1	UTSW	19	40314689	missense	probably benign	0.29
R4733:Sorbs1	UTSW	19	40314689	missense	probably benign	0.29
R4860:Sorbs1	UTSW	19	40337005	missense	probably benign	0.44
R4860:Sorbs1	UTSW	19	40337005	missense	probably benign	0.44
R4907:Sorbs1	UTSW	19	40340047	nonsense	probably null
R4912:Sorbs1	UTSW	19	40311727	missense	probably damaging	1.00
R5229:Sorbs1	UTSW	19	40340707	missense	probably damaging	1.00
R5285:Sorbs1	UTSW	19	40321890	missense	probably damaging	1.00
R5416:Sorbs1	UTSW	19	40376989	missense	probably benign	0.06
R5706:Sorbs1	UTSW	19	40376881	missense	probably benign
R5871:Sorbs1	UTSW	19	40398583	missense	probably damaging	1.00
R5936:Sorbs1	UTSW	19	40324772	missense	probably damaging	0.96
R6073:Sorbs1	UTSW	19	40314657	missense	probably damaging	1.00
R6324:Sorbs1	UTSW	19	40321819	missense	probably damaging	0.99
R6343:Sorbs1	UTSW	19	40376982	critical splice donor site	probably null
R6561:Sorbs1	UTSW	19	40326052	missense	probably benign
R6646:Sorbs1	UTSW	19	40325549	missense	probably damaging	1.00
R6768:Sorbs1	UTSW	19	40327547	missense	probably damaging	1.00
R6849:Sorbs1	UTSW	19	40376800	missense	probably benign
R6850:Sorbs1	UTSW	19	40376800	missense	probably benign
R6878:Sorbs1	UTSW	19	40376800	missense	probably benign
R6879:Sorbs1	UTSW	19	40376800	missense	probably benign
R6880:Sorbs1	UTSW	19	40376800	missense	probably benign
R6908:Sorbs1	UTSW	19	40352332	missense	probably damaging	1.00
R6980:Sorbs1	UTSW	19	40327616	nonsense	probably null
R7040:Sorbs1	UTSW	19	40376800	missense	probably benign
R7041:Sorbs1	UTSW	19	40376800	missense	probably benign
R7110:Sorbs1	UTSW	19	40376800	missense	probably benign
R7122:Sorbs1	UTSW	19	40376800	missense	probably benign
R7170:Sorbs1	UTSW	19	40326129	nonsense	probably null
R7180:Sorbs1	UTSW	19	40376800	missense	probably benign
R7185:Sorbs1	UTSW	19	40376800	missense	probably benign
R7187:Sorbs1	UTSW	19	40376800	missense	probably benign
R7254:Sorbs1	UTSW	19	40376800	missense	probably benign
R7255:Sorbs1	UTSW	19	40376800	missense	probably benign
R7595:Sorbs1	UTSW	19	40314653	missense	probably damaging	0.99
R7819:Sorbs1	UTSW	19	40376800	missense	probably benign
R7876:Sorbs1	UTSW	19	40296588	missense	probably damaging	1.00
R7894:Sorbs1	UTSW	19	40327576	missense	probably benign	0.02
R7986:Sorbs1	UTSW	19	40365005	missense	probably damaging	0.99
R8031:Sorbs1	UTSW	19	40326489	missense	probably benign	0.17
R8082:Sorbs1	UTSW	19	40365083	missense	probably benign	0.08
R8282:Sorbs1	UTSW	19	40376800	missense	probably benign
R8283:Sorbs1	UTSW	19	40376800	missense	probably benign
R8446:Sorbs1	UTSW	19	40326158	missense	probably benign
R8526:Sorbs1	UTSW	19	40376800	missense	probably benign
R8527:Sorbs1	UTSW	19	40376800	missense	probably benign
R8528:Sorbs1	UTSW	19	40376800	missense	probably benign
R8539:Sorbs1	UTSW	19	40376800	missense	probably benign
R8540:Sorbs1	UTSW	19	40376800	missense	probably benign
R8542:Sorbs1	UTSW	19	40376800	missense	probably benign
R8543:Sorbs1	UTSW	19	40376800	missense	probably benign
R8544:Sorbs1	UTSW	19	40376800	missense	probably benign
R8545:Sorbs1	UTSW	19	40376800	missense	probably benign
R8684:Sorbs1	UTSW	19	40376800	missense	probably benign
R8699:Sorbs1	UTSW	19	40376800	missense	probably benign
R8702:Sorbs1	UTSW	19	40376800	missense	probably benign
R8752:Sorbs1	UTSW	19	40361428	critical splice donor site	probably null
R8937:Sorbs1	UTSW	19	40373562	missense	probably benign	0.02
R8956:Sorbs1	UTSW	19	40363216	missense	probably damaging	1.00
R8960:Sorbs1	UTSW	19	40398604	missense	probably damaging	0.98
R9175:Sorbs1	UTSW	19	40326574	missense	probably damaging	1.00
R9208:Sorbs1	UTSW	19	40365018	start gained	probably benign
R9211:Sorbs1	UTSW	19	40344354	critical splice donor site	probably null
R9371:Sorbs1	UTSW	19	40326880	missense	probably damaging	0.98
R9374:Sorbs1	UTSW	19	40373479	nonsense	probably null
R9377:Sorbs1	UTSW	19	40398604	missense	probably damaging	0.98
R9551:Sorbs1	UTSW	19	40373479	nonsense	probably null
R9552:Sorbs1	UTSW	19	40373479	nonsense	probably null
R9686:Sorbs1	UTSW	19	40393510	missense	probably damaging	1.00
Z1177:Sorbs1	UTSW	19	40326895	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- TCCAGCAAGCTTACGGTACTTG -3'
(R):5'- ACCCCTTATTTCCCACAGGGTG -3'

Sequencing Primer
(F):5'- AGCTTACGGTACTTGAGACAGCTC -3'
(R):5'- CAGCCCCGTCTGAGGTAATAGTTG -3'

Posted On

2019-09-13